NYMU Taipei/Lab Notes/2007 8 6&7
From 2007.igem.org
(Difference between revisions)
Line 2: | Line 2: | ||
* mouse insulin gene cloning (delay to 8/7) | * mouse insulin gene cloning (delay to 8/7) | ||
** primer design for [http://www.informatics.jax.org/searches/accession_report.cgi?id=MGI%3A96573 insulin II of Mus musculus] | ** primer design for [http://www.informatics.jax.org/searches/accession_report.cgi?id=MGI%3A96573 insulin II of Mus musculus] | ||
+ | *** primer for A chain | ||
+ | *** primer for B chain | ||
+ | **** left: TTTGTCAAGCAGCACCTTTG | ||
+ | **** right: GGACATGGGTGTGTAGAAGA | ||
* purchase of BCRC human insulin clone (ordered not paid) | * purchase of BCRC human insulin clone (ordered not paid) |
Revision as of 13:41, 6 August 2007
Lab schedule
- mouse insulin gene cloning (delay to 8/7)
- primer design for insulin II of Mus musculus
- primer for A chain
- primer for B chain
- left: TTTGTCAAGCAGCACCTTTG
- right: GGACATGGGTGTGTAGAAGA
- primer design for insulin II of Mus musculus
- purchase of BCRC human insulin clone (ordered not paid)