Paris/July 27

From 2007.igem.org

(Difference between revisions)
(→Ligations)
(→Ligations)
Line 56: Line 56:
|width=25%| Vector
|width=25%| Vector
|width=5%| Vector Volume (µL)
|width=5%| Vector Volume (µL)
-
|width=35%| Comments
+
|width=30%| Comments
 +
|width=5%| Number of colonies
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
-
| style="background: #ccffcc;" |Control 1
+
| style="background: #ccffcc;" |Control 0
|
|
|
|
Line 64: Line 65:
|
|
|control of transformation efficiency
|control of transformation efficiency
 +
|4
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |Control 1
| style="background: #ccffcc;" |Control 1
Line 71: Line 73:
|
|
|control of ligation efficiency
|control of ligation efficiency
 +
|~80
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |Control 2
| style="background: #ccffcc;" |Control 2
Line 76: Line 79:
|
|
|MP3.1 digested with EcoRI (D0)
|MP3.1 digested with EcoRI (D0)
-
|
 
|without ligase in the mix: control of digestion efficiency
|without ligase in the mix: control of digestion efficiency
 +
|0
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |Control 3
| style="background: #ccffcc;" |Control 3
Line 85: Line 88:
|2µl
|2µl
|control of D9.2 digestion
|control of D9.2 digestion
 +
|6
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |Control 4
| style="background: #ccffcc;" |Control 4
Line 92: Line 96:
|2µl
|2µl
|control of D15.2 digestion
|control of D15.2 digestion
 +
|1
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |Control 5
| style="background: #ccffcc;" |Control 5
Line 99: Line 104:
|2µl
|2µl
|control of D22.1 digestion
|control of D22.1 digestion
 +
|0
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |L1
| style="background: #ccffcc;" |L1
Line 106: Line 112:
|2
|2
|construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad)
|construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad)
 +
|12
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |L6
| style="background: #ccffcc;" |L6
Line 113: Line 120:
|2
|2
|construction of the biobrick strong RBS(B0030)-Cre ORF
|construction of the biobrick strong RBS(B0030)-Cre ORF
 +
|~150
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |L9
| style="background: #ccffcc;" |L9
Line 120: Line 128:
|2 (+6 H2O)
|2 (+6 H2O)
|lox66 cloned as a biobrick in pSB1A2
|lox66 cloned as a biobrick in pSB1A2
 +
|0
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |L10
| style="background: #ccffcc;" |L10
Line 127: Line 136:
|2 (+6 H2O)
|2 (+6 H2O)
|lox71 cloned as a biobrick
|lox71 cloned as a biobrick
 +
|0
|}
|}

Revision as of 10:59, 30 July 2007

Contents

PCR to perform

The following PCR reactions have been performed

  • P5
  • P6
  • P8
  • P9

Oligo design for Wanner deletion

We were for now on not able to perform the deletion of DapA through transduction. So we will try the deletion through the Wanner method. We will also attempt the deletion of FtsZ.

We will use the protocol of the keio collection: [1]

  • 20nt of upstream region of kan gene,

5'-ATTCCGGGGATCCGTCGACC-3' (P1)

  • 20nt of kan downstream sequence,

5'-TGTAGGCTGGAGCTGCTTCG-3' (P2)

DapA deletion

  • 50nt DapA upstream region

5'-CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATG-3' (P3)

  • 50nt DapA downstream region (reverse complement)

5'-AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGC-3' (P4)

  • dDapA-F

CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATGATTCCGGGGATCCGTCGACC (P3 + P1)

  • dDapA-R

AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)

FtsZ deletion

  • 50nt FtsZ upstream region

5'-GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATG-3' (P5)

  • 50nt FtsZ downstream region (reverse complement)

5'-GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGC-3' (P6)

  • dFtsZ-F

GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATGATTCCGGGGATCCGTCGACC (P5 + P1)

  • dFtsZ-R

GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)


Ligations

Ligations
Number Insert Insert Volume (µL) Vector Vector Volume (µL) Comments Number of colonies
Control 0 pUC19 control of transformation efficiency 4
Control 1 MP3.1 digested with EcoRI (D0) control of ligation efficiency ~80
Control 2 MP3.1 digested with EcoRI (D0) without ligase in the mix: control of digestion efficiency 0
Control 3 D9.1 (J61002 ready for insertion of a FI) 2µl control of D9.2 digestion 6
Control 4 D15.1 (B0030 BV) 2µl control of D15.2 digestion 1
Control 5 D22.2 (pSB1A2 Eco, Pst) 2µl control of D22.1 digestion 0
L1 D23.2 (AraC/pBad promoter FI) 8 D9.1 (J61002 ready for insertion of a FI) 2 construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad) 12
L6 D14.2(Cre ORF) 8 D15.1 (B0030 BV) 2 construction of the biobrick strong RBS(B0030)-Cre ORF ~150
L9 lox66 [O14+O15] (0.2µM) 2 D22.2 (pSB1A2 Eco, Pst) 2 (+6 H2O) lox66 cloned as a biobrick in pSB1A2 0
L10 lox71 [O16+O17] (0.2µM) 2 D22.2 (pSB1A2 Eco, Pst) 2 (+6 H2O) lox71 cloned as a biobrick 0

Ligation mix:

  • 2µl TP
  • 1µl Ligase
  • 7µl H20

Reaction in 20µl

ON @ 4°C

Minipreps

minipreps were performed on the following ON cultures:

cultures of different clones of the ligation reactions of 25/07/07

  • L1.2 & L1.3
  • L2.1 & L2.2
  • L9
  • L10
  • L6.1, L6.2 & L6.3

for more detail on these ligation reactions, go to 25/07/07

no glycerol stocks of hese strains have been generated yet (the culyures are launched tonight in order to do this)

minipreps & glycerol stocks:

  • MP12.1 & MP12.2 (2 clones after transformation with biobrick BBa_P1003)
Retrieved from "http://2007.igem.org/wiki/index.php/Paris/July_27"