http://2007.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Xiaofeng+Su&year=&month=2007.igem.org - User contributions [en]2024-03-28T19:55:30ZFrom 2007.igem.orgMediaWiki 1.16.5http://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2009-08-24T13:10:18Z<p>Xiaofeng Su: /* Undergruduate Student of Cellular and Molecular Biology,USTC */</p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13877561295<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure.1.'''My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|'''Figure.2.''' My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc.' ChemBioChem 2005, 6, 1628 – 1637]]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|'''Figure.3.'''Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|'''Figure.4.'''Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|'''Figure.5.'''The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|'''Figure.6.'''The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|'''Figure.7.'''My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|'''Figure.8.'''Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|'''Figure.9.'''retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 10''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 11''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
*;Repressor Design in silico<br />
<br />
Besides my artificial design work in experiment, we also conduct a program for screening the target repressor-promoter pairs via computational biology mainly by Ding Bo, shown as the following website: [[Repressor Design in silico]]<br />
<br />
*;[[Reference]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2008-08-08T18:43:30Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure.1.'''My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|'''Figure.2.''' My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc.' ChemBioChem 2005, 6, 1628 – 1637]]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|'''Figure.3.'''Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|'''Figure.4.'''Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|'''Figure.5.'''The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|'''Figure.6.'''The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|'''Figure.7.'''My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|'''Figure.8.'''Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|'''Figure.9.'''retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 10''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 11''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
*;Repressor Design in silico<br />
<br />
Besides my artificial design work in experiment, we also conduct a program for screening the target repressor-promoter pairs via computational biology mainly by Ding Bo, shown as the following website: [[Repressor Design in silico]]<br />
<br />
*;[[Reference]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/Repressor_Design_in_silicoRepressor Design in silico2008-07-11T05:51:59Z<p>Xiaofeng Su: </p>
<hr />
<div>https://2007.igem.org/USTC/Repressor_Evolution_in_Silico</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2008-07-11T05:50:32Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure.1.'''My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|'''Figure.2.''' My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc.' ChemBioChem 2005, 6, 1628 – 1637]]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|'''Figure.3.'''Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|'''Figure.4.'''Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|'''Figure.5.'''The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|'''Figure.6.'''The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|'''Figure.7.'''My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|'''Figure.8.'''Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|'''Figure.9.'''retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 10''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 11''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
*;Repressor Design in silico<br />
<br />
Besides my artificial design work in experiment, we also conduct a program for screening the target repressor-promoter pairs via computational biology, shown as the following website: [[Repressor Design in silico]]<br />
<br />
*;[[Reference]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/ResultsResults2007-12-10T06:30:37Z<p>Xiaofeng Su: </p>
<hr />
<div><html><br />
<style type="text/css"><br />
<br />
#awardtable p {<br />
padding: .2em;<br />
background-color: #fbf9da;<br />
border-bottom: 1px solid #e3eafe;<br />
}<br />
<br />
table{<br />
clear:both;<br />
margin: 0 10px;<br />
font-size: 12px;<br />
font-family: "Lucida Grande", Verdana, Arial, sans-serif;<br />
border-collapse: collapse;<br />
margin: auto;<br />
}<br />
<br />
td{<br />
vertical-align: top;<br />
}<br />
<br />
table.medals{<br />
width: 400px;<br />
margin: 0 10px;<br />
}<br />
<br />
table.medals td{<br />
padding: .2em .1em;<br />
text-align: center;<br />
}<br />
<br />
table.results tr{<br />
border-bottom: 1px dashed #e3eafe;<br />
}<br />
<br />
tr.grandprize{<br />
//background-color: #e3eafe;<br />
font-weight: bold;<br />
}<br />
<br />
th{<br />
background-color: #fbf9da;<br />
border-bottom: 1px solid #e3eafe;<br />
}<br />
<br />
table.results td{<br />
padding:.5em .5em .1em .1em;<br />
}<br />
<br />
#awardcolumn{<br />
text-align: right;<br />
}<br />
<br />
#teamcolumn{<br />
color: #ff9328;<br />
text-align: right;<br />
}<br />
<br />
</style><br />
<br />
<div id="awardtable"><br />
<p>Awards</p><br />
<table><br />
<tr><br />
<td><br />
<table class="results" style="float:left;"><br />
<col id="awardcolumn"><br />
<col id="teamcolumn"><br />
<tr><th>Award</th><th>Team</th></tr><br />
<tr class="grandprize"><td>Grand Prize</td><td>Peking</td></tr><br />
<br />
<tr><br />
<td>Finalists</td><br />
<td><table><br />
<tr><td>UC Berkeley</td><td>Ljubljana</td></tr><br />
<tr><td>Paris</td><td>UCSF</td></tr><br />
<tr><td>Peking</td><td>USTC</td></tr><br />
</table></td><br />
</tr><br />
<br />
<tr class="tracks"><td>Foundational Research</td><td>Paris</td></tr><br />
<tr class="tracks"><td>Environmental Sensing</td><td>Glasgow</td></tr><br />
<tr class="tracks"><td>Information Processing</td><td>Peking</td></tr><br />
<tr class="tracks"><td>Energy</td><td>Alberta</td></tr><br />
<tr class="tracks"><td>Health & Medicine</td><td>Ljubljana</td></tr><br />
<tr class="extras"><td>Best BioBrick Part</td><td>Cambridge + Melbourne</td></tr><br />
<tr class="extras"><td>Best Foundational Tech.</td><td>USTC</td></tr><br />
<tr class="extras"><td>Best Modeling / Sim.</td><td>Bangalore</td></tr><br />
<tr class="extras"><td>Best Poster</td><td>Berkeley + Calgary</td></tr><br />
<tr class="extras"><td>Best Presentation</td><td>ETHZ</td></tr><br />
</table><br />
</td><br />
<td><br />
<p>Gold Medalists</p><br />
<table class="medals"><br />
<tr><br />
<td>Alberta</td><br />
<td>Edinburgh</td><br />
<td>Paris</td><br />
<td>Tokyo Tech</td><br />
</tr><br />
<tr><br />
<td>Bangalore</td><br />
<td>ETHZ</td><br />
<td>Peking</td><br />
<td>Tsinghua</td><br />
</tr><br />
<tr><br />
<td>Berkeley</td><br />
<td>Freiburg</td><br />
<td>Penn State</td><br />
<td>UCSF</td><br />
</tr><br />
<tr><br />
<td>Bologna</td><br />
<td>Glasgow</td><br />
<td>Princeton</td><br />
<td>USTC</td><br />
</tr><br />
<tr><br />
<td>Brown</td><br />
<td>Harvard</td><br />
<td>Rice</td><br />
<td>Valencia</td><br />
</tr><br />
<tr><br />
<td>Calgary</td><br />
<td>Imperial</td><br />
<td>Southern Utah</td><br />
<td>Virginia Tech</td><br />
</tr><br />
<tr><br />
<td>Caltech</td><br />
<td>Lethbridge</td><br />
<td>St. Petersberg</td><br />
<td>Ljubljana</td><br />
</tr><br />
<tr><br />
<td>Cambridge</td><br />
<td>Melbourne</td><br />
<td>Taipei</td><br />
<td>&nbsp;</td><br />
</tr><br />
<tr><br />
<td>Davidson-Missouri</td><br />
<td>MIT</td><br />
<td>Tianjin</td><br />
<td></td><br />
</tr><br />
</table> <br />
<br />
<p>Silver Medalists</p><br />
<table class="medals"><br />
<tr><br />
<td>Bay Area RSI</td><br />
<td>McGill</td><br />
<td>Naples</td><br />
<td>Toronto</td><br />
</tr><br />
<tr><br />
<td>Virginia</td><br />
<td>Waterloo</td><br />
<td>&nbsp;</td><br />
<td>&nbsp;</td><br />
</tr><br />
</table><br />
<br />
<p>Bronze Medalists</p><br />
<table class="medals"><br />
<tr><br />
<td>Berkeley LBL</td><br />
<td>Boston U</td><br />
<td>Chiba</td><br />
<td>Colombia-Israel</td><br />
</tr><br />
<tr><br />
<td>CSHL</td><br />
<td>Duke</td><br />
<td>Mexico</td><br />
<td>Michigan </td><br />
</tr><br />
<tr><br />
<td>Mississippi</td><br />
<td>Missouri Miners</td><br />
<td>Purdue</td><br />
<td>Turkey</td><br />
</tr><br />
<tr><br />
<td>Wisconson</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
</table> <br />
</td><br />
</tr><br />
</table><br />
</div><br />
</html><br />
<br />
<br />
<html><br />
<style type="text/css"><br />
<br />
.mis{}<br />
<br />
#randyBookReset{<br />
position: relative; <br />
width: 768px;<br />
margin: auto;<br />
}<br />
<br />
#randyBookReset p {<br />
margin: 0px;<br />
}<br />
<br />
.resultcol{<br />
font-family: "Lucida Grande", Verdana, Arial, sans-serif;<br />
position: relative:<br />
width: 364px;<br />
margin: 2px 5px;<br />
}<br />
<br />
.resultcol p{<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
.teambar{<br />
background-color: #f9f9f9;<br />
background-position: left top;<br />
background-repeat: no-repeat;<br />
position: relative;<br />
background-image: url(https://2007.igem.org/wiki/jam07media/images/resultbar_bg.jpg);<br />
width: 360px;<br />
height: 30px;<br />
margin: 6px 0 0 0;<br />
padding: 0;<br />
<br />
}<br />
<br />
.teambar p{<br />
font-size: 11pt;<br />
font-weight: bold;<br />
line-height: 28px;<br />
font-family: "Lucida Grande", Verdana, Arial, sans-serif;<br />
margin: 0;<br />
padding: 2px 6px 0 6px;<br />
}<br />
<br />
.resulticons {<br />
height: 28px;<br />
position: absolute;<br />
right: 3px;<br />
top: 2px;<br />
}<br />
<br />
img.seal {<br />
padding-right: 6px;<br />
}<br />
<br />
.resulticons a img {<br />
padding: 0;<br />
border-style: none;<br />
//border: 1px solid red;<br />
}<br />
<br />
.awardbar{<br />
background-color: #ddfcbf;<br />
background-position: 0 bottom;<br />
background-repeat: no-repeat;<br />
background-image: url(https://2007.igem.org/wiki/jam07media/images/awardbar_bg.jpg);<br />
width: 360px;<br />
min-height: 27px;<br />
margin: 0;<br />
padding: 0;<br />
}<br />
<br />
.awardbar p{<br />
font-size: 9pt;<br />
font-family: "Lucida Grande", Verdana, Arial, sans-serif;<br />
font-style: italic;<br />
line-height: 18px;<br />
margin: 0px;<br />
padding: 2px 12px;<br />
}<br />
<br />
.finalist{<br />
color: ff1b7c;<br />
}<br />
<br />
</style><br />
<br />
<div id="randyBookReset"> <!-- container start --><br />
<br />
<div class="resultcol" style="float: left;"> <!-- LEFT COLUMN BEGINS--><br />
<br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Alberta</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" title="gold medal! sweet!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Alberta.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Alberta.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>First Place - Energy</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Bangalore</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Bangalore.mp4" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Bangalore.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>Best in Modeling / Simulation</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p class="mis">Bay Area RSI</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="Sorry, the slides are missing" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_BayAreaRSI.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>UC Berkeley</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_UCBerkeley.mp4" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_UCBerkeley.ppt" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">Grand Prize Finalist</span> + Best Poster <small>(w/ Calgary)</small></p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Berkeley LBL</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_BerkeleyLBL.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_BerkeleyLBL.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Bologna</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Bologna.mp4" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Bologna.pdf" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Boston University</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_BostonUniversity.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_BostonUniversity.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p class="mis">Brown University</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Brown.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="Sorry! The Brown video presentation is not available" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Calgary</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Calgary.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Calgary.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>Best Poster <small>(w/ UC Berkeley)</small></p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Caltech</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Caltech.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Caltech.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Cambridge</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Cambridge.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Cambridge.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>Best BioBrick Part <small>(shared w/ Melbourne)</small></p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Chiba</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Chiba.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Chiba.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Cold Spring Harbor Labs</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_CSHL.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_CSHL.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p class="mis">Colombia-Israel</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="Sorry, the Coombia-Israel presentation is not available" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Colombia-Israel.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Davidson - Missouri Western</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Davidson-MissouriW.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Davidson-MissouriW.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Duke</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Duke.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Duke.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>ETH Zurich</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_ETHZ.pptx" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_ETHZ.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>Best Presentation</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Edinburgh</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Edinburgh.zip" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Edinburgh.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Freiburg</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Freiburg.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Freiburg.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Glasgow</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Glasgow.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Glasgow.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">First Place - Environmental Sensing</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Harvard</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Harvard.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Harvard.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Imperial</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Imperial.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Imperial.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p class="mis">Lethbridge</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Lethbridge.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Lethbridge.mp4" title="Unfortunately, the video from the lethbridge presentation is not available"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Ljubljana</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Ljubljana.zip" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Ljubljana.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">Grand Prize Finalist</span> + First Place - Health & Medicine</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>McGill</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_McGill.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_McGill.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
</div><br />
<!-- ################### LEFT COLUMN ENDS ################## --><br />
<br />
<br />
<br />
<!-- ################## RIGHT COLUMN BEGINS ################ --><br />
<div class="resultcol" style="float:right;"> <br />
<br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Melbourne</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Melbourne.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Melbourne.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p>Best BioBrick Part <small>(shared w/ Cambridge)</small></p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Mexico</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Mexico.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Mexico.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Michigan</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Michigan.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Michigan.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Mississippi</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Mississippi.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Mississippi.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Missouri Miners</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_MissouriMiners.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_MissouriMiners.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Naples & TIGEM</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Naples.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Naples.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Paris</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Paris.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Paris.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">Grand Prize Finalist</span> + First Place - Foundational Research</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Peking</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Peking.zip" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Peking.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist"><strong>Grand Prize Winner</strong></span> + First Place - Information Processing</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Penn State</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_PennState.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_PennState.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Princeton</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Princeton.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Princeton.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Purdue</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Purdue.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Purdue.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Rice</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Rice.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>St. Petersburg</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_StPetersburg.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_StPetersburg.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Southern Utah</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_SUtah.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_SUtah.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Taipei</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Taipei.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Taipei.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Tianjin</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Tianjin.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Tianjin.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Tokyo Alliance</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_TokyoAlliance.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_TokyoAlliance.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Toronto</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Toronto.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Toronto.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Tsinghua</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Tsinghua.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Tsinghua.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Turkey</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Turkey.pptx" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Turkey.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>UCSF</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_UCSF.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_UCSF.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">Grand Prize Finalist</span></p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>USTC</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_USTC.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_USTC.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- Award, if present --><br />
<div class="awardbar"><br />
<p><span class="finalist">Grand Prize Finalist</span> + Best Foundational Technology</p><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Valencia</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Valencia.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Valencia.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Virginia</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Virginia.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Virginia.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Virginia Tech</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_gold.jpg" alt="gold medal" title="This team received a gold medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_VirginiaTech.pdf" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_VirginiaTech.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Waterloo</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_silver.jpg" alt="silver medal" title="This team received a silver medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Waterloo.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Waterloo.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
<!-- ********************** Begin Entry ******************** --><br />
<div class="teambar"><br />
<br />
<!-- TEAM NAME --><br />
<p>Wisconson</p><br />
<br />
<div class="resulticons"><br />
<!-- GOLD, SILVER, or BRONZE --><br />
<img src="https://2007.igem.org/wiki/jam07media/images/results_seal_bronze.jpg" alt="bronze medal" title="This team received a bronze medal!" width="26" height="26" class="seal"/> <br />
<!-- PDF URL --><br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Wisconson.ppt" title="pdf"><img src="https://2007.igem.org/wiki/jam07media/images/results_pdf_icon.jpg" alt="image" width="26" height="26" /></a><br />
<!-- MOVIE URL --> <br />
<a href="https://2007.igem.org/wiki/jam07media/Jam07_Wisconson.mp4" title="video"><img src="https://2007.igem.org/wiki/jam07media/images/results_mpeg_icon.jpg" alt="image" width="26" height="26" /></a><br />
</div><br />
</div><br />
<!-- ********************** End Entry ********************** --><br />
</div> <!-- RIGHT COLUMN ENDS --><br />
<br />
</div> <!-- container --><br />
<br />
</html><br />
<br />
<br style="clear:both;"/><br />
Head to the [[Medals|<font size=3><font color=dodgerblue><u>'''Medals page'''</u></font></font>]] to see the teams that won Gold, Silver, and Bronze medals.</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-26T14:04:33Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
*;[[Reference]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-26T14:02:58Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
[['''Reference''']]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-26T14:02:29Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
[[Reference]]<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/ReferenceReference2007-10-26T14:02:07Z<p>Xiaofeng Su: </p>
<hr />
<div>1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-26T13:58:06Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
'''a) Repression Matrix '''<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
'''b)Orthologal Repression Matrix'''<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-26T13:46:31Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
*;Key Results<br />
<br />
<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T16:11:28Z<p>Xiaofeng Su: </p>
<hr />
<div>The Repression Matrix comes from other's previous work results[[USTC/RepressionMatrixFromLiterature#References|[7,8,9]]]. However, we hardly get an 'ORM' because the cross repression are obvious according to this results. i.e. we may not obtain stable Repressor-Promoter Pairs as our wires with high fidelity. <br />
<br />
[[Image:USTC_MullerRepression.png|thumb|center|800px|'''Figure I''' The same with the former RM that red color represents a high repression while blue represent reverse. This Matrix are not directly from literatures but from the data by previous research work.]]<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T16:07:20Z<p>Xiaofeng Su: </p>
<hr />
<div>The Repression Matrix comes from other's previous work results[7,8,9]. However, we hardly get an 'ORM' because the cross repression are obvious according to this results. i.e. we may not obtain stable Repressor-Promoter Pairs as our wires with high fidelity. <br />
<br />
[[Image:USTC_MullerRepression.png|thumb|center|800px|'''Figure I''' The same with the former RM that red color represents a high repression while blue represent reverse. This Matrix are not directly from literatures but from the data by previous research work.]]<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T16:03:25Z<p>Xiaofeng Su: </p>
<hr />
<div>The Repression Matrix comes from other's previous work results[7,8,9]. However, we hardly get an 'ORM' because the cross repression are obvious according to this results. i.e. we may not obtain stable Repressor-Promoter Pairs as our wires with high fidelity. <br />
<br />
[[Image:USTC_MullerRepression.png|thumb|center|800px|'''Figure I''' The same with the former RM that red color represents a high repression while blue represent reverse. This Matrix are not directly from literatures but from the data by previous research work.]]</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_MullerRepression.pngFile:USTC MullerRepression.png2007-10-25T13:32:36Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T13:32:21Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_MullerRepression.png]]</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T13:31:33Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_MullerRepression]]</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/RepressionMatrixFromLiteratureUSTC/RepressionMatrixFromLiterature2007-10-25T13:29:51Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_MullerRepression.jpg]]</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-25T13:28:48Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site [[USTC/Repressor_Evolution_on_Plates#References|[1, 10]]], and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is moderate [[USTC/Repressor_Evolution_on_Plates#References|[11]]].<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted [[USTC/Repressor_Evolution_on_Plates#References|[2]]]. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization [[USTC/Repressor_Evolution_on_Plates#References|[1]]].<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
The lac repressor in Lac operon is a well-studied transcriptional factor involved in the metabolism of lactose in bacteria. It has three distinct regions :<br />
<br />
* a headpiece which recognize DNA and joins two monomers to form a dimer at the same time<br />
* a core region which binds allolactose and IPTG<br />
* a tetramerization region which joins four monomers in an alpha-helix bundle)<br />
<br />
The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity and high affinity [[USTC/Repressor_Evolution_on_Plates#References|[6]]]. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis [[USTC/Repressor_Evolution_on_Plates#References|[4, 5]]], it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
=== Repression Matrix ===<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature [[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]] and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-25T13:27:46Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site [[USTC/Repressor_Evolution_on_Plates#References|[1, 10]]], and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is moderate [[USTC/Repressor_Evolution_on_Plates#References|[11]]].<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted [[USTC/Repressor_Evolution_on_Plates#References|[2]]]. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization [[USTC/Repressor_Evolution_on_Plates#References|[1]]].<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
The lac repressor in Lac operon is a well-studied transcriptional factor involved in the metabolism of lactose in bacteria. It has three distinct regions :<br />
<br />
* a headpiece which recognize DNA and joins two monomers to form a dimer at the same time<br />
* a core region which binds allolactose and IPTG<br />
* a tetramerization region which joins four monomers in an alpha-helix bundle)<br />
<br />
The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity and high affinity [[USTC/Repressor_Evolution_on_Plates#References|[6]]]. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis [[USTC/Repressor_Evolution_on_Plates#References|[4, 5]]], it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
=== Repression Matrix ===<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature [[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]] and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-25T13:26:16Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site [[USTC/Repressor_Evolution_on_Plates#References|[1, 10]]], and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is moderate [[USTC/Repressor_Evolution_on_Plates#References|[11]]].<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted [[USTC/Repressor_Evolution_on_Plates#References|[2]]]. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization [[USTC/Repressor_Evolution_on_Plates#References|[1]]].<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
The lac repressor in Lac operon is a well-studied transcriptional factor involved in the metabolism of lactose in bacteria. It has three distinct regions :<br />
<br />
* a headpiece which recognize DNA and joins two monomers to form a dimer at the same time<br />
* a core region which binds allolactose and IPTG<br />
* a tetramerization region which joins four monomers in an alpha-helix bundle)<br />
<br />
The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity and high affinity [[USTC/Repressor_Evolution_on_Plates#References|[6]]]. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis [[USTC/Repressor_Evolution_on_Plates#References|[4, 5]]], it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
=== Repression Matrix ===<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature [[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]] and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an Orthogonal Matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-24T19:38:14Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
Unlike the real wires of electrocircuit board, in cytoplasm, chemical signaling molecules in an relatively open systems. For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.Then quantitative test for repression intensity have been completed by GFP fluorescence microscope assay and [https://2007.igem.org/USTC/BetaGalactosidaseAssay Beta-Galactosidase assay ] for the expression quantity of GFP and beta-galactosidase. But before, we should define a Repression Value that can represent a repression intensity of each binding condition.<br />
<br />
[[Image:USTC_allen11.jpg]] [[Image:USTC_allen11.jpg]]<br />
<br />
<br />
*;Key Results<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-24T19:32:30Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|400px]]<br />
<br />
<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_rv.jpgFile:USTC rv.jpg2007-10-24T19:24:19Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-24T19:23:56Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg]]<br />
<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-24T18:59:15Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_RepressionScheme.jpgFile:USTC RepressionScheme.jpg2007-10-24T18:40:40Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_crossrepressiontest.jpgFile:USTC crossrepressiontest.jpg2007-10-24T18:29:36Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-24T18:29:13Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 9''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 10''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-24T18:27:15Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest]]<br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 9''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 10''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-23T05:47:41Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP). <br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordination sheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
=== Repression Scheme ===<br />
<br />
[[Image:USTC_RepressionScheme]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 9''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 10''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-23T05:46:34Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP). <br />
<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. The sets of R.V. is depicted on the scheme below which have been transform to corresponding Repression Matrix-more visual that the coordination sheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
=== Repression Scheme ===<br />
<br />
[[Image:USTC_RepressionScheme]]<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 9''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 10''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-23T02:56:02Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP). <br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix:The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show up]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:57:37Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix:The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show up]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:52:05Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix:The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the deeper the blue is the weaker the repression will show up]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:49:54Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix:The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the deeper the blue is the weaker the repression will show up]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]][[Image:USTC_RepressionMatrix-cutline.jpg|thumb|right|200px]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:47:32Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix:The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the deeper the blue is the weaker the repression will show up]][[Image:USTC_RepressionMatrix-cutline.jpg|thumb|right]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:29:59Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix]][[Image:USTC_RepressionMatrix-cutline.jpg|thumb|right]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:29:06Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix]]<br />
[[Image:USTC_RepressionMatrix-cutline.jpg|thumb|right]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:28:25Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|left|600px|'''Figure 7''' Repression Metrix]]<br />
[[Image:USTC_RepressionMatrix-cutline.jpg|thumb|right]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-22T14:25:24Z<p>Xiaofeng Su: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is limited.<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|300px|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
[http://en.wikipedia.org/wiki/Lac_repressor From Wikipedia]: <br />
<br />
The lac repressor is a DNA-binding protein which inhibits the expression of genes coding for proteins involved in the metabolism of lactose in bacteria. It is active in the absence of lactose, ensuring that the bacterium only invests energy in the production of machinery necessary for the uptake and metabolism of lactose when lactose is present. When lactose becomes available, it is converted into allolactose, which inhibits the lac repressor's DNA binding ability.<br />
<br />
The lac repressor protein has three distinct regions:<br />
<br />
* a core region (which binds allolactose)<br />
* a tetramerization region (which joins four monomers in an alpha-helix bundle)<br />
* a DNA-binding region (in which two LacI proteins bind a single operator site)<br />
<br />
The lac repressor occurs as a tetramer (four identical subunits bound together). This can be viewed as two dimers, with each dimer being able to bind to a single lac operator. The two subunits each bind to a slightly separated (major groove) region of the operator. The promoter is slightly covered by the lac repressor so RNAP cannot bind to and transcribe the operon.<br />
<br />
The DNA binding region consists of a helix-turn-helix structural motif.<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis, it is possible to create a library of mutatants containing all possible mutations at these positions. For the targeted sites are near to the beginning of the <i>lacI</i> gene, but beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family like Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, expressing the repressor constitutively. The second plasmid is composed of two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_<i>target</i>-lacZa. White colonies, in which repressors can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured using ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
== Results ==<br />
<br />
=== Repression Matrix ===<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|600px|'''Figure 7''' Repression Metrix]]<br />
[[Image:USTC_RepressionMatrix-cutline.jpg]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|300px|'''Figure 8''' Orthologal Repression Metrix]]<br />
<br />
== References ==</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_RepressionMatrix-cutline.jpgFile:USTC RepressionMatrix-cutline.jpg2007-10-22T14:24:04Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T18:01:24Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conducted a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.Then quantitative test for repression intensity have been completed by GFP fluorescence microscope assay and [https://2007.igem.org/USTC/BetaGalactosidaseAssay Beta-Galactosidase assay ] for the expression quantity of GFP and beta-galactosidase. But before, we should define a Repression Value that can represent a repression intensity of each binding condition.<br />
<br />
[[Image:USTC_allen11.jpg]] [[Image:USTC_allen11.jpg]]<br />
<br />
<br />
*;Key Results<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T17:42:11Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conduct a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.Then quantitative test for repression intensity have been completed by GFP fluorescence microscope assay and Beta-Galactosidase assay <br />
*;Key Results<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T17:26:41Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
'''(D)'''I've conduct a 'cross repression' test by transforming the selected repressors to their specific promoter-reporter system and other non-specific promoter-reporter systems.Then quantitative test for repression intensity have been completed by GFP fluorescence microscope assay and Beta- <br />
*;Key Results<br />
<br />
*;Difficulties & Overcome</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T17:14:38Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg|thumb|left|300px|Figure.7.My arranged selection work desciption]] [[Image:USTC_allen7.jpg|thumb|right|200px|Figure.8.Selection Results-the Red-Mark the colony are a target]]<br />
[[Image:USTC_allen8.jpg|thumb|center|300px|Figure.9.retest of my results of P-R pairs]]<br />
<br />
<br />
*;Key Results</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_allen8.jpgFile:USTC allen8.jpg2007-10-20T17:05:43Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_allen7.jpgFile:USTC allen7.jpg2007-10-20T17:04:47Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/File:USTC_allen10.jpgFile:USTC allen10.jpg2007-10-20T17:03:36Z<p>Xiaofeng Su: </p>
<hr />
<div></div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T17:01:34Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen10.jpg]] [[Image:USTC_allen7.jpg]]<br />
[[Image:USTC_allen8.jpg]] [[Image:USTC_allen9.jpg]]<br />
<br />
<br />
*;Key Results</div>Xiaofeng Suhttp://2007.igem.org/wiki/index.php/USTC/SuXiaofengUSTC/SuXiaofeng2007-10-20T17:01:01Z<p>Xiaofeng Su: </p>
<hr />
<div>[[Image:USTC_ALLEN.jpg|thumb|left|Xiaofeng Su(Allen Su)-Undergraduate of Cellular and Molecular Biology in School of Life Sciences, USTC, P.R. China]] <br />
==XIAOFENG SU==<br />
=====Undergruduate Student of Cellular and Molecular Biology,USTC=====<br />
<br />
<br />
'''Email:''' [mailto:allensue@mail.ustc.edu.cn allensue@mail.ustc.edu.cn] (preference) or [mailto:xiaofsu@gmail.com xiaofsu@gmail.com]<br />
<br />
'''Phone:''' +86-551-3602469 (Lab)<br />
<br />
'''Mobile:''' +86-13866722084<br />
<br />
'''Address:''' Room 439, School of Life Sciences, USTC, Hefei, Anhui, P.R.China, 230026<br />
<br />
=====Research Interest=====<br />
<br />
*Directed Evolution for Seeking New Protein-DNA Interactions<br />
<br />
*Approaches of Synthetic Biology for Forming Novel "Genetic Engineering Machines"<br />
<br />
*Differentiation and Development of Stem Cells<br />
<br />
'''Research Work'''<br />
<br />
*;Overall Description<br />
<br />
For obtaining the signaling transduction parts of repression with high fidelity, I've experimentally designed and acquired some specific repressor-promoter pairs(R-P pairs or P-R pairs)based on Lactose Operon by directed evolution on plate. Besides, through quantitative assay,the novel artificial R-P pairs I selected have been tested for their binding performance so that P-R pairs of highest affinity and specificity can make a figure out of P-R pair candidates. Most of the parts in my work have been BioBricks-Standardized and work as BioBrick parts.<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|My project description by visual comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
[[Image:USTC_allen2.jpg|thumb|right|200px|My Work Basis-By Redesigning lac-repressor and operator. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637''']]<br />
<br />
*;Experimental Design<br />
#Construction of Expression Library of Lac-Repressor Family [Collaboration]<br />
#Synthesis of Promoter Sequence with Specific Operators<br />
#Construction of Low-copy Reporter System with Specific Opertors<br />
#Selection of Promoter-Repressor Pair(P-R Pair) including re-testing validity of these combination<br />
#Transfering the Operators to Double Reporter Systems [Collaboration]<br />
#Quantitative assay of Repression Intensity and Specificity of P-R Pairs<br />
#Results From RM(Repression Matrix) to ORM(Orthogonal RM)<br />
<br />
<br />
*;Work Process and Summary<br />
'''(A)'''The Directed Evolution must be conducted on the base of 2 components-the repressor system and promoter-reporter system.By collaborations with other team members, I've successfully establish these two systems shown as below.[[Image:USTC_allen3.jpg|thumb|left|300px|Three kinds of plasmids birthing random mutated repressor called repressor system]][[Image:USTC_allen4.jpg|thumb|center|380px|Four kinds of plasmids with different specific promoters containing lacZalpha as reporter gene]]<br />
<br />
<br />
'''(B)'''Within the work of establishment of two selection systems, a time consuming step is synthesis of target specific promoters that contain the mutated site design by Do. On account of economic and convenient aspect, I use 2-Step unparallel PCR by 3 fragments of primers and 2 times of PCR with different reaction conditions.As Below.<br />
<br />
[[Image:USTC_allen5.jpg|thumb|left|320px|The PCR plan for synthesis of specific promoters]][[Image:USTC_allen6.jpg|thumb|center|300px|The PCR Results]]<br />
<br />
<br />
<br />
'''(C)'''I've develop the selection work by the means of Blue White Selection on top agar Luria-Bertani broth to obtain the R-P pairs.Below are some pictures from my experiment design and experiment work.<br />
<br />
[[Image:USTC_allen6.jpg]] [[Image:USTC_allen7.jpg]]<br />
[[Image:USTC_allen8.jpg]] [[Image:USTC_allen9.jpg]]<br />
<br />
<br />
*;Key Results</div>Xiaofeng Su