http://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&feed=atom&action=historyUSTC/Repressor Evolution on Plates - Revision history2024-03-28T22:08:19ZRevision history for this page on the wikiMediaWiki 1.16.5http://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=46726&oldid=prevMaRui at 01:37, 27 October 20072007-10-27T01:37:56Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 01:37, 27 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 2:</td>
<td colspan="2" class="diff-lineno">Line 2:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 14:</td>
<td colspan="2" class="diff-lineno">Line 15:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Start: Lac repressor ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Start: Lac repressor ==</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 26:</td>
<td colspan="2" class="diff-lineno">Line 28:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Selection of operator sequence ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Selection of operator sequence ==</div></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 39:</td>
<td colspan="2" class="diff-lineno">Line 42:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> O77 gacgactgtatacagtcgtc</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div> O77 gacgactgtatacagtcgtc</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">----</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Directed Repressor Evolution ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Directed Repressor Evolution ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 69:</td>
<td colspan="2" class="diff-lineno">Line 76:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_ crossrepressiontest.jpg|center|600px]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_ crossrepressiontest.jpg|center|600px]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">----</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Results ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== Results ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 96:</td>
<td colspan="2" class="diff-lineno">Line 107:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">----</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>MaRuihttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=37575&oldid=prevZhanJian: /* Orthologal Repression Matrix */2007-10-25T16:29:52Z<p><span class="autocomment">Orthologal Repression Matrix</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 16:29, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 92:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|<del class="diffchange diffchange-inline">center</del>|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|<ins class="diffchange diffchange-inline">rught</ins>|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]], which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] <ins class="diffchange diffchange-inline">shown in Figure 9</ins>, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td></tr>
</table>ZhanJianhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=37574&oldid=prevZhanJian: /* Orthologal Repression Matrix */2007-10-25T16:29:25Z<p><span class="autocomment">Orthologal Repression Matrix</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 16:29, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 91:</td>
<td colspan="2" class="diff-lineno">Line 91:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;"></del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del style="color: red; font-weight: bold; text-decoration: none;">Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</del></div></td><td colspan="2"> </td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]], which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td></tr>
</table>ZhanJianhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36893&oldid=prevXiaofeng Su at 13:28, 25 October 20072007-10-25T13:28:48Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 13:28, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 81:</td>
<td colspan="2" class="diff-lineno">Line 81:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The directed results are charted on one coordinate scheme.</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>The directed results are charted on one coordinate scheme.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionScheme.jpg|thumb|center|<del class="diffchange diffchange-inline">500px</del>|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionScheme.jpg|thumb|center|<ins class="diffchange diffchange-inline">550px</ins>|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>--></div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>--></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
</table>Xiaofeng Suhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36889&oldid=prevXiaofeng Su at 13:27, 25 October 20072007-10-25T13:27:46Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 13:27, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 92:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an <del class="diffchange diffchange-inline">Orthogonal Matrix </del>in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an <ins class="diffchange diffchange-inline">orthogonal matrix </ins>in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td></tr>
</table>Xiaofeng Suhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36882&oldid=prevXiaofeng Su at 13:26, 25 October 20072007-10-25T13:26:16Z<p></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 13:26, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 91:</td>
<td colspan="2" class="diff-lineno">Line 91:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"></ins></div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, the target resized matrix-Orthogonal Repression Matrix, which looks like an Orthogonal Matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td></tr>
</table>Xiaofeng Suhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36228&oldid=prevZhanJian: /* Repression Matrix */2007-10-25T08:53:40Z<p><span class="autocomment">Repression Matrix</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 08:53, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 86:</td>
<td colspan="2" class="diff-lineno">Line 86:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div><del class="diffchange diffchange-inline">[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' </del>Repression <del class="diffchange diffchange-inline">Metrix(RM):The repression matrix reveals the binding affinity </del>of <del class="diffchange diffchange-inline">different repressor candidates </del>with <del class="diffchange diffchange-inline">various specific promoters by different colors</del>. <del class="diffchange diffchange-inline">The deeper </del>the <del class="diffchange diffchange-inline">red will be</del>, <del class="diffchange diffchange-inline">the higher the repression will appear. While the lighter the blue </del>is <del class="diffchange diffchange-inline">the weaker the repression will show.</del>]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins class="diffchange diffchange-inline">Performances of our wires are shown as so-called "</ins>Repression <ins class="diffchange diffchange-inline">Matrix", an array </ins>of <ins class="diffchange diffchange-inline">R.V. </ins>with <ins class="diffchange diffchange-inline">variant combinations of artificial repressors and operators</ins>. <ins class="diffchange diffchange-inline">A "Repression Matrix" taken from </ins>the <ins class="diffchange diffchange-inline">literature [[USTC/Repressor_Evolution_on_Plates#References|[7</ins>,<ins class="diffchange diffchange-inline">8,9]]] and uniformed </ins>is <ins class="diffchange diffchange-inline">also plotted in [[USTC/RepressionMatrixFromLiterature|this page</ins>]]<ins class="diffchange diffchange-inline">.</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>[[<del class="diffchange diffchange-inline">USTC/Repressor_Evolution_on_Plates#References</del>|<del class="diffchange diffchange-inline">[7,</del>8,<del class="diffchange diffchange-inline">9]</del>]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>[[<ins class="diffchange diffchange-inline">Image:USTC_RepressionMatrix.png</ins>|<ins class="diffchange diffchange-inline">thumb|center|500px|'''Figure </ins>8<ins class="diffchange diffchange-inline">''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be</ins>, <ins class="diffchange diffchange-inline">the higher the repression will appear. While the lighter the blue is the weaker the repression will show.</ins>]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
</table>ZhanJianhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36199&oldid=prevZhanJian: /* Repression Matrix */2007-10-25T08:46:34Z<p><span class="autocomment">Repression Matrix</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 08:46, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 86:</td>
<td colspan="2" class="diff-lineno">Line 86:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionMatrix.png|thumb|center|<del class="diffchange diffchange-inline">600px</del>|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionMatrix.png|thumb|center|<ins class="diffchange diffchange-inline">500px</ins>|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]]</div></td></tr>
</table>ZhanJianhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36198&oldid=prevZhanJian: /* Orthologal Repression Matrix */2007-10-25T08:46:23Z<p><span class="autocomment">Orthologal Repression Matrix</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 08:46, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 92:</td>
<td colspan="2" class="diff-lineno">Line 92:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Orthologal Repression Matrix ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'>-</td><td style="background: #ffa; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|<del class="diffchange diffchange-inline">300px</del>|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div>[[Image:USTC_OrthologalRepressionMatrix.png|thumb|center|<ins class="diffchange diffchange-inline">200px</ins>|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>== References ==</div></td></tr>
</table>ZhanJianhttp://2007.igem.org/wiki/index.php?title=USTC/Repressor_Evolution_on_Plates&diff=36183&oldid=prevZhanJian: /* Repression Scheme */2007-10-25T08:40:32Z<p><span class="autocomment">Repression Scheme</span></p>
<table style="background-color: white; color:black;">
<col class='diff-marker' />
<col class='diff-content' />
<col class='diff-marker' />
<col class='diff-content' />
<tr valign='top'>
<td colspan='2' style="background-color: white; color:black;">← Older revision</td>
<td colspan='2' style="background-color: white; color:black;">Revision as of 08:40, 25 October 2007</td>
</tr><tr><td colspan="2" class="diff-lineno">Line 76:</td>
<td colspan="2" class="diff-lineno">Line 76:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;"><!--</ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Scheme ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Scheme ===</div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td colspan="2" class="diff-lineno">Line 81:</td>
<td colspan="2" class="diff-lineno">Line 82:</td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>[[Image:USTC_RepressionScheme.jpg|thumb|center|500px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]</div></td></tr>
<tr><td colspan="2"> </td><td class='diff-marker'>+</td><td style="background: #cfc; color:black; font-size: smaller;"><div><ins style="color: red; font-weight: bold; text-decoration: none;">--></ins></div></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"></td></tr>
<tr><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td><td class='diff-marker'> </td><td style="background: #eee; color:black; font-size: smaller;"><div>=== Repression Matrix ===</div></td></tr>
</table>ZhanJian