Melbourne/Plan/Blue Photosensor

From 2007.igem.org

(Difference between revisions)
Line 1: Line 1:
-
[[Melbourne|<Back to team home page>]]  
+
[[Melbourne/Plan|<return to top of plan>]]  [[melbourne|<return to home page>]]    [[Melb:Blue Photosensor|<next>]]
-
=Preliminaries=
+
== insert plan here ==
-
#      Usefull links [[Melbourne/primary Restriction enzymes|(restriction enzymes)]][[Melbourne/Software|
+
-
 
+
-
(Software)]][[http://www.openwetware.org/wiki/Designing_primers|<open wetware primer design>]]
+
-
 
+
-
[[http://www.mcb.uct.ac.za/pcroptim.htm|<more primer design>]]
+
-
#      Sequences:
+
-
##      Ncbi genebank AF053765  [[Melbourne/AF053765-pNL26|(pNL26 7371bp)]]  [[Melbourne/AF053765-pNL29|(pNL29
+
-
 
+
-
6036bp)]] [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
+
-
 
+
-
[[Melbourne/AF053765FASTA| (FASTA seq.)]]
+
-
##      pBluescriptIIKS+ [http://www.stratagene.com/products/displayProduct.aspx?pid=267 (stratagene) ]
+
-
 
+
-
[http://www.stratagene.com/vectors/sequences/pbl2ksp_s.txt (sequence) ]
+
-
 
+
-
[http://www.stratagene.com/vectors/restriction_sites/pbl2ksp_r.txt (restriction map) ]
+
-
 
+
-
[http://www.stratagene.com/vectors/maps/pdf/pBluescript%20II%20KS+_%20webpg.pdf (map) ]
+
-
 
+
-
[http://www.stratagene.com/manuals/212205.pdf (Manual)]
+
-
##*[[Melbourne/pBluescriptIIKS nospaces|(no spaces sequence 2961bp)]]
+
-
##*HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701  ,Xbal cuts at 677  ,SpeI cuts at 683
+
-
##*[[Melbourne/pBluescriptIIKS PstI HindIII |(no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)]]
+
-
##      pNL26 Plasmid with insert:[[Melbourne/cannon plasmid pNL26 seq| (seq 10318bp)]] [[Melbourne/cannon plasmid
+
-
 
+
-
pNL26 res map| (res map)]] [[Melbourne/cannon plasmid pNL26 HindIII digest|(digests)]] [[Melbourne cannon plasmid
+
-
 
+
-
pNL26 rev compl seq|(reverse complement)]]
+
-
###    pNL26 insert PstI--HindIII:[[Melbourne/AF053765-pNL26|(pNL26 7371bp)]]
+
-
##      pNL29 Plasmid with insert:[[Melbourne/cannon plasmid pNL29 seq| (seq 8983bp)]] [[Melbourne/cannon plasmid
+
-
 
+
-
pNL29 res map| (res map)]] [[Melbourne/cannon plasmid pNL29 HindIII digest| (digests)]] [[Melbourne cannon plasmid
+
-
 
+
-
pNL29 rev compl seq|(reverse complement)]]
+
-
###    pNL29 insert PstI--HindIII:[[Melbourne/AF053765-pNL29|(pNL29 6036bp)]]
+
-
##Frame arrangement for Biobrick protein expression.
+
-
##Biobrick expression plasmid system.
+
-
##Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations
+
-
###design primers
+
-
###create registery parts
+
-
##pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators.
+
-
##pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU
+
-
###design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required.
+
-
###create registery parts
+
-
#Other investigations
+
-
## Locate putative transcription terminators.
+
-
## Locate putative ribosome binding sites.
+
-
## Locate putative regulation sequences/ promotors.
+
-
## Confirm putative genes.
+
-
## Blast search homology of each putative ORF & gene.
+
-
## Produce phylogenic maps of Gvps.
+
-
==Steps:==
+
-
# Recovery of genes: (2 days)
+
-
## Recover the plasmid from paper provided into solution.(method)
+
-
## Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock)
+
-
##      pick 3 colonies of each
+
-
## Overnight Culture x9(6 above and 3 form agar block provided)
+
-
##      Miniprep
+
-
##      Produce glycerol stocks
+
-
## Confirm presence in recovered sample using digest.(HindIII)
+
-
##      ->Established Supply of Plasmid
+
-
# Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days)
+
-
##      Confirm transcription RT-PRC,
+
-
##      Confirm translation (buoyant phenotype method).
+
-
##      Confirm translation (Namarski optics (direct interferance contrast microscopy method).
+
-
# Removal of four biobrick like restriction sites all in GvpL.
+
-
##      DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon [[Melbourne/Ecoli K12 usage|(result)]]
+
-
##      [[Melbourne QuickchangeXL|(Quickchange XL Kit)]][http://www.stratagene.com/sdmdesigner/default.aspx (Primer
+
-
 
+
-
design program) ] [http://www.stratagene.com/downloads/qc/200521.pdf (Manual)][[Melbourne/GvpL site dirrected
+
-
 
+
-
primers|(Primer program output)]] [[Melbourne/Gvp site dirrected primers|(hand designed primers ordered)]]
+
-
## EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)]
+
-
##*    Replace with [GA A][AAT][TC A]  Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%).
+
-
## PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)]
+
-
##*    Replace with [CTG][CAA]  Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
+
-
## XbaI [TCTAGA] (not present)
+
-
## SpeI [ACTAGT] (not present)
+
-
# Insertion of biobrick required restriction sites by PCR primer modification.(method)
+
-
## Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
+
-
###PREFIX Primer 3cctttctagag5 11 bp adds XbaI
+
-
###SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I)
+
-
###In Frame for expression when combined with Lac promotor.
+
-
## Primer generation
+
-
## Plasmid extraction from culture
+
-
## PCR
+
-
## Restriction EcoR1 & Spe1
+
-
## Gel separation
+
-
## Restriction of standard Library death plasmid EcoR1,Spe1.
+
-
## Ligation.
+
-
## Transform host with regulated POPS output
+
-
## Confirm dna, rna , protein (as for A)
+
-
==supplementary material for use in experiments==
+
-
*pNL26 parts:
+
-
**GvpA [[melbourne/GvpA DNA sequence|(DNA sequence)]] [[Melbourne/GvpA protein sequence| (protein sequence)]]
+
-
***EcoRI restriction site 7089 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original
+
-
 
+
-
source)]
+
-
***coden pair change: Isoleucine T57C: [ATT](K12 usage 30%) to [ATC](K12 usage 25%).(adds EcoRV)
+
-
***Primer T57AF 5'-ttagcagaagtgattgatcgaatcctcgacaaagggattg-3'
+
-
***Primer T57AR 5'-caatccctttgtcgaggattcgatcaatcacttctgctaa-3'
+
-
 
+
-
 
+
-
**GvpP [[melbourne/GvpP DNA sequence|(DNA sequence)]] [[Melbourne/GvpP protein sequence| (protein sequence)]]
+
-
***PstI restriction site 6389 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original
+
-
 
+
-
source)]
+
-
***coden pair change:Glutamine G441A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
+
-
***mutation Primer G441AF 5'-aatatgaacgaccagctgcaacgcattgaagagatg-3'
+
-
***mutation Primer G441AR 5'-catctcttcaatgcgttgcagctggtcgttcatatt-3'
+
-
 
+
-
**GvpQ [[melbourne/GvpQ DNA sequence|(DNA sequence)]] [[Melbourne/GvpQ protein sequence| (protein sequence)]]
+
-
***PstI two restriction sites 6136 & 6169 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519|
+
-
 
+
-
(original source)]
+
-
***coden pair change:Glutamine G150A,G183A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
+
-
***mutation Primer #1 G150AF: 5'-aaaactgaagggaaactgcaagaaaaagcaaatgaagcgtc-3'
+
-
***mutation Primer #1 G150AR: 5'-gacgcttcatttgctttttcttgcagtttcccttcagtttt-3'
+
-
***mutation Primer #1 G183AF: 5'-atgaagcgtcagaaaaactgcaagaaacaaaagaaaaaaatgccc-3'
+
-
***mutation Primer #1 G183AR: 5'-gggcatttttttcttttgtttcttgcagtttttctgacgcttcat-3'
+
-
 
+
-
***mutation primer #2
+
-
**ORF1 [[melbourne/ORF1 DNA sequence|(DNA sequence)]] [[Melbourne/ORF1 protein sequence| (protein sequence)]]
+

Revision as of 12:14, 6 August 2007

<return to top of plan> <return to home page> <next>

insert plan here

Retrieved from "http://2007.igem.org/wiki/index.php/Melbourne/Plan/Blue_Photosensor"