BerkiGEM2007-VaibhaviConstructionFile8

From 2007.igem.org

(Difference between revisions)
 
(2 intermediate revisions not shown)
Line 1: Line 1:
<pre>
<pre>
-
Biobrickification of composite Ptet + RFP (product = I716251)
+
 
-
---------------------------------------------------
+
Method Used: dBBS
-
Digest pBca9145-Bca1145 (BglII/BsaI, 1783+970, L)
+
 
-
Sub into pBca9145-Bca9205 (BamHI/BsaI/AlwNI, 1049+553+449, L)
+
PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp)
-
Product is I716251
+
Digest pBca9145-Bca1090 (BsaI/BamHI, 989+1102, S)
-
---------------------------------------------------
+
Product is I716258
-
No Oligos Needed
+
Ligate with Part B
 +
-------------------------------------
 +
ca1099F – ccaaaAGATCTatgaaacgttttagtctggc
 +
G00101 – gctagCTCGAGttaGGATCCttacttaattacaccacaggc
 +
 
 +
 
 +
PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp)
 +
Digest pBca9145-I716253 (BsaI/BglII, 2512 + 777, L)
 +
Product is I716259
 +
Ligate with Part A
 +
-------------------------------------
 +
ca998 – gtatcacgaggcagaatttcag
 +
ca1099R – gctgataaatctggagccgg
 +
 
 +
Final product is I716260
 +
 
</pre>
</pre>

Latest revision as of 20:25, 8 August 2007


Method Used: dBBS

PCR ca1099F/G00101 on Part A (pBca9145-Bca1090)	(553 bp)
Digest pBca9145-Bca1090				(BsaI/BamHI, 989+1102, S)
Product is I716258
Ligate with Part B
-------------------------------------
ca1099F – ccaaaAGATCTatgaaacgttttagtctggc
G00101 – gctagCTCGAGttaGGATCCttacttaattacaccacaggc


PCR ca998/ca1099R on Part B (pBca9145-I716253)	(3393 bp)
Digest pBca9145-I716253				(BsaI/BglII, 2512 + 777, L)
Product is I716259
Ligate with Part A
-------------------------------------
ca998 – gtatcacgaggcagaatttcag
ca1099R – gctgataaatctggagccgg

Final product is I716260