BerkiGEM2007-VaibhaviConstructionFile8
From 2007.igem.org
(Difference between revisions)
(2 intermediate revisions not shown) | |||
Line 1: | Line 1: | ||
<pre> | <pre> | ||
- | + | ||
- | -------------------------------------- | + | Method Used: dBBS |
- | + | ||
- | + | PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp) | |
- | Product is | + | Digest pBca9145-Bca1090 (BsaI/BamHI, 989+1102, S) |
- | ------------------------------------- | + | Product is I716258 |
- | + | Ligate with Part B | |
+ | ------------------------------------- | ||
+ | ca1099F – ccaaaAGATCTatgaaacgttttagtctggc | ||
+ | G00101 – gctagCTCGAGttaGGATCCttacttaattacaccacaggc | ||
+ | |||
+ | |||
+ | PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp) | ||
+ | Digest pBca9145-I716253 (BsaI/BglII, 2512 + 777, L) | ||
+ | Product is I716259 | ||
+ | Ligate with Part A | ||
+ | ------------------------------------- | ||
+ | ca998 – gtatcacgaggcagaatttcag | ||
+ | ca1099R – gctgataaatctggagccgg | ||
+ | |||
+ | Final product is I716260 | ||
+ | |||
</pre> | </pre> |
Latest revision as of 20:25, 8 August 2007
Method Used: dBBS PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp) Digest pBca9145-Bca1090 (BsaI/BamHI, 989+1102, S) Product is I716258 Ligate with Part B ------------------------------------- ca1099F – ccaaaAGATCTatgaaacgttttagtctggc G00101 – gctagCTCGAGttaGGATCCttacttaattacaccacaggc PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp) Digest pBca9145-I716253 (BsaI/BglII, 2512 + 777, L) Product is I716259 Ligate with Part A ------------------------------------- ca998 – gtatcacgaggcagaatttcag ca1099R – gctgataaatctggagccgg Final product is I716260