Template:BerkiGEM2007 AustinAlcoholInformation

From 2007.igem.org

Revision as of 02:15, 12 August 2007

AustinDay 22:15, 11 August 2007 (EDT)

• I cut out the band of the ADHE part, but my digest for the petDUET plasmid looks like it went bad. I'm growing up another clone to mini prep tomorrow so I can finish that construct.

AustinDay 22:26, 3 August 2007 (EDT)

• Oligos received and pcr started for overnight run. I used a genomic mini prep of TG1 cells from the -80 for the template. I don't exactly have an assay on hand just yet, I'm hoping to finishing looking that up tonight.

AustinDay 21:08, 2 August 2007 (EDT)

• I ordered the oligos to pcr out the adhE gene. I'll put it straight into the petDUET plasmid at one of the expression sites.
• The assays will consist of the ADH assay (spectroscopic detection of NADH production)
• I was a bit confused about the assay to detect the enzymatic reaction of the acetaldehyde dehydrogenase activity, I thought I read that it converts NADH back to NAD, but I don't think that's right because then they wouldn't be getting a reading for the ADH activity... I'll read more carefully. Anyway, here's the candidate gene.

atggctgttactaatgtcgctgaacttaacgcactcgtagagcgtgtaaaaaaagcccagcgtgaatatgccagtttcactcaagagcaagtagacaaaatcttccgcgccgccgctctggctgctgcagatgctcgaatcccactcgcgaaaatggccgttgccgaatccggcatgggtatcgtcgaagataaagtgatcaaaaaccactttgcttctgaatatatctacaacgcctataaagatgaaaaaacctgtggtgttctgtctgaagacgacacttttggtaccatcactatcgctgaaccaatcggtattatttgcggtatcgttccgaccactaacccgacttcaactgctatcttcaaatcgctgatcagtctgaagacccgtaacgccattatcttctccccgcacccgcgtgcaaaagatgccaccaacaaagcggctgatatcgttctgcaggctgctatcgctgccggtgctccgaaagatctgatcggctggatcgatcaaccttctgttgaactgtctaacgcactgatgcaccacccagacatcaacctgatcctcgcgactggtggtccgggcatggttaaagccgcatacagctccggtaaaccagctatcggtgtaggcgcgggcaacactccagttgttatcgatgaaactgctgatatcaaacgtgcagttgcatctgtactgatgtccaaaaccttcgacaacggcgtaatctgtgcttctgaacagtctgttgttgttgttgactctgtttatgacgctgtacgtgaacgttttgcaacccacggcggctatctgttgcagggtaaagagctgaaagctgttcaggatgttatcctgaaaaacggtgcgctgaacgcggctatcgttggtcagccagcctataaaattgctgaactggcaggcttctctgtaccagaaaacaccaagattctgatcggtgaagtgaccgttgttgatgaaagcgaaccgttcgcacatgaaaaactgtccccgactctggcaatgtaccgcgctaaagatttcgaagacgcggtagaaaaagcagagaaactggttgctatgggcggtatcggtcatacctcttgcctgtacactgaccaggataaccaaccggctcgcgtttcttacttcggtcagaaaatgaaaacggcgcgtatcctgattaacaccccagcgtctcagggtggtatcggtgacctgtataacttcaaactcgcaccttccctgactctgggttgtggttcttggggtggtaactccatctctgaaaacgttggtccgaaacacctgatcaacaagaaaaccgttgctaagcgagctgaaaacatgttgtggcacaaacttccgaaatctatctacttccgccgtggctccctgccaatcgcgctggatgaagtgattactgatggccacaaacgtgcgctcatcgtgactgaccgcttcctgttcaacaatggttatgctgatcagatcacttccgtactgaaagcagcaggcgttgaaactgaagtcttcttcgaagtagaagcggacccgaccctgagcatcgttcgtaaaggtgcagaactggcaaactccttcaaaccagacgtgattatcgcgctgggtggtggttccccgatggacgccgcgaagatcatgtgggttatgtacgaacatccggaaactcacttcgaagagctggcgctgcgctttatggatatccgtaaacgtatctacaagttcccgaaaatgggcgtgaaagcgaaaatgatcgctgtcaccaccacttctggtacaggttctgaagtcactccgtttgcggttgtaactgacgacgctactggtcagaaatatccgctggcagactatgcgctgactccggatatggcgattgtcgacgccaacctggttatggacatgccgaagtccctgtgtgctttcggtggtctggacgcagtaactcacgccatggaagcttatgtttctgtactggcatctgagttctctgatggtcaggctctgcaggcactgaaactgctgaaagaatatctgccagcgtcctaccacgaagggtctaaaaatccggtagcgcgtgaacgtgttcacagtgcagcgactatcgcgggtatcgcgtttgcgaacgccttcctgggtgtatgtcactcaatggcgcacaaactgggttcccagttccatattccgcacggtctggcaaacgccctgctgatttgtaacgttattcgctacaatgcgaacgacaacccgaccaagcagactgcattcagccagtatgaccgtccgcaggctcgccgtcgttatgctgaaattgccgaccacttgggtctgagcgcaccgggcgaccgtactgctgctaagatcgagaaactgctggcatggctggaaacgctgaaagctgaactgggtattccgaaatctatccgtgaagctggcgttcaggaagcagacttcctggcgaacgtggataaactgtctgaagatgcattcgatgaccagtgcaccggcgctaacccgcgttacccgctgatctccgagctgaaacagattctgctggatacctactacggtcgtgattatgtagaaggtgaaactgcagcgaagaaagaagctgctccggctaaagctgagaaaaaagcgaaaaaatccgcttaa

• A phenotypic assay that chris suggested would be to put our bacteria into heat killed horse serum with some ethanol, then use some method to measure the amount of ethanol left. Sounds good to me. It exemplifies the chassis as well as the detoxification ability, brilliant!

AustinDay 01:42, 31 July 2007 (EDT)

• Can we create an injectable bacterium that can make you sober up quickly? I dunno, let's figure it out.
• I think we want Class I alcohol dehydrogenases. They have a lower Km, however there are many different polymorphisms of class I ADHs with different Kms, it appears as though having many different types would be the best/most biomimetic approach.
• The first step catalyzed by the alcohol dehydrogenase is the limiting step right now.
• The second enzyme, acetaldehyde dehydrogenase will break down the very toxic acetaldehyde to acetic acid, which you pee out. This is the pathway that ~90% of ethanol is metabolized by.
• This might be a good place to use John's scaffolding technology to fuse the two enzymes together to reduce the concentration of the toxic intermediate? That'd be fun.