USTC/Repressor Evolution on Plates
From 2007.igem.org
m (→Results) |
m (→Results) |
||
Line 73: | Line 73: | ||
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity. | The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity. | ||
- | [[Image:USTC_rv.jpg| | + | [[Image:USTC_rv.jpg|500px|center]] |
Revision as of 08:39, 25 October 2007
Contents |
Wires in Bio-logic Circuit
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.
Why to Design Artificial High-Specific Repressor-Operator Pairs
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site [1, 10], and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,
- The number of natural regulators well studied is moderate [11].
- Natural regulators do have some disadvantages.
- For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted [2].
- There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations.
- This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization [1].
Start: Lac repressor
The lac repressor in Lac operon is a well-studied transcriptional factor involved in the metabolism of lactose in bacteria. It has three distinct regions :
- a headpiece which recognize DNA and joins two monomers to form a dimer at the same time
- a core region which binds allolactose and IPTG
- a tetramerization region which joins four monomers in an alpha-helix bundle)
The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[1,3].
Selection of operator sequence
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity and high affinity [6]. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain lacI and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).
O11 aattgtgagcgctcacaatt O22 aattgtaagcgcttacaatt O33 aattgtaaacgtttacaatt O44 aattgtgaacgttcacaatt O55 aattttgagcgctcaaaatt O66 aattatgagcgctcataatt O77 gacgactgtatacagtcgtc
Directed Repressor Evolution
Targeted Mutagenesis
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis [4, 5], it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the lacI gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.
Repression Assay
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, lacZ (alpha fragment) and gfp-AAV, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.
Screening
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.
Quantitive Assay(Cross Repression Test)
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.
Results
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.
Repression Scheme
The directed results are charted on one coordinate scheme.
Repression Matrix
Orthologal Repression Matrix
References
1. Lewis, M. (2005), 'The lac repressor.', C R Biol 328 (6), 521--548.
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', EMBO J 21(12), 2866--2876.
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology, Humana Press, Volume 230, 2003
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', PNAS 80(22), 6785--6789.
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', EMBO J 6(10), 3145--3153.
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. PNAS, 1988, 85, 7947-7951
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', EMBO J 8(4), 1265--1270.
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' Chembiochem, 2005, 6, 1628-1637
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' Curr Opin Microbiol, 1998, 1, 145-151