|
|
| (6 intermediate revisions not shown) |
| Line 1: |
Line 1: |
| | [[McGill|McGill Home]] | | [[McGill|McGill Home]] |
| | | | |
| - | [[McGill/Team_1:_Fluorescence_Complementation|Go to Team 1]] | + | [[McGill/Team_1:_Hai-ya|Go to Team 1]] |
| | <br> | | <br> |
| | + | |
| | | | |
| | '''[[McGill/June|June 2007]]'''<br> | | '''[[McGill/June|June 2007]]'''<br> |
| - | '''[[McGill/July|July 2007]]'''<br> | + | |
| | + | '''[[McGill/July|July 2007]]'''<br> |
| | + | |
| | + | '''[[McGill/August|August 2007]]'''<br> |
| | + | |
| | + | '''[[McGill/September|September 2007]]'''<br> |
| | + | |
| | + | '''[[McGill/October|October 2007]]'''<br> |
| | | | |
| | <div valign="center"> | | <div valign="center"> |
| Line 78: |
Line 86: |
| | </tr> | | </tr> |
| | </table></td><td><td><td> | | </table></td><td><td><td> |
| | + | |
| | + | </tr></table> |
| | + | </td></tr> |
| | + | |
| | + | |
| | | | |
| | == May 2007 == | | == May 2007 == |
| Line 182: |
Line 195: |
| | 8uL water<br> | | 8uL water<br> |
| | | | |
| - | <u>Jh0001</u><br> | + | <u>J40001</u><br> |
| | 1.5uL Buffer 3<br> | | 1.5uL Buffer 3<br> |
| | 0.5uL BSA<br> | | 0.5uL BSA<br> |
| Line 212: |
Line 225: |
| | | | |
| | Dilutions where implemented on the seedings from yesterday | | Dilutions where implemented on the seedings from yesterday |
| - |
| |
| - | == July 2007 ==
| |
| - | ===July 1===
| |
| - | *Diluted seedings of I+J (in supp. M.M.), J40001, I15004 (in Top10 cells with LB), I5610.
| |
| - | *To the dilutions, after an O.D. of 0.2-0.3 was reached, IPTG/DOX/AHL were all added to each biobrick dilution, and another dilution was left as a control. <p>
| |
| - | <u>Results:</u> I5610 (repressilator) did not show any fluorescence in the confocal microscope.<br>
| |
| - | J40001 showed some fluorescence.<br>
| |
| - | The samples of I+J, J & I in AHL/DOX/IPTG were then left longer in incubation and then viewed on the confocal again.
| |
| - |
| |
| - | <u>Results:</u> I5610 again showed no fluorescence, J40001 very little, and the I+J was continually drifting, we concluded that this was probably due to an illumination problem of the microscope equipment itself and not the DNA.
| |
| - | *Seeded I+J in supp. M.M. again for the plate reader experiment tomorrow.
| |
| - |
| |
| - | ===July 3===
| |
| - | *A superconcentrated midiprep of the I5610 cells was done as following the elution of the plasmid, the DNA was all pooled into 1mL of ethanol this making it doubly concentrated.
| |
| - | *A large-scale digest of I15004 was conducted using the following formula<br>
| |
| - | 10uL buffer<br>
| |
| - | 0.5uL BSA<br>
| |
| - | 20uL DNA<br>
| |
| - | 17.5uL water<br>
| |
| - | 1uL SpeI<br>
| |
| - | 1uLXbaI<br>
| |
| - | Following the digest, a gel extraction was conducted to isolate the I insert and the DNA was stored in the freezer. Unfortunately, the cuts may have severed the resistance of the insert thus it cannot be used in further ligation steps. Alternatively, a PCR of the plasmid will be done to isolate the insert to be ligated into another plasmid with a high copy number.
| |
| - |
| |
| - | *A further transformation og I5610 into MC4100 cells was repeated with a 2 minute HS and plated on AMP/Kan plates as the previous attempt at imaging showed no florescence indicating a bad tranformation or DNA sample.
| |
| - |
| |
| - | *I+J were viewed on the plate reader at different concentrations (in 350ul M.M. and in 1ml M.M.) after reaching an O.D. between 0.2-0.3 and a series of consecutive washings in MM. A kinetic reading was then taken over 2 hours, with 5 minute intervals, with a high sensitivity and at 32C. The excitation wavelength as set to 430nm and the emission wavelength was set to 475nm. A transparent cover was placed atop the plate reader to prevent drying out over the testing period.<p>
| |
| - | Results: The were possibly oscillations at both high and low concentrations, with a greater change in the diluted I+J. The results seemed to show only the end point of the oscillation, where the graph levels off.
| |
| - | *A third plate reading experiment was done with a newer batch of O.D.'d I+J cells, to see a pull cycle of oscillations. The results seemed promising, however, after showing it to Jay, she concluded that the fluorescence intensities were too random to be substantial.
| |
| - |
| |
| - | ===July 4===
| |
| - | *A large scale digest was done again, this time using different restriction enzymes (XbaI & BanII), with cuts at 1.8Kb and 3.8Kb on a 5.6 Kb plasmid. The digest was then run on a gel with large wells for 1h20mins. When viewed on the computer, the cuts were precise and the bands were clear. <br> We then proceeded with gel extraction in the evening after cutting out the I15004 insert. However the I15004 extraction was useless as we later found out that the restriction enzymes used also cut some of the Kan antibiotic resistance from the plasmid, thus making the insert unusable.
| |
| - | * Seeded I+J in supplemented Minimal Media.
| |
| - | * As there were no more miniprepped J brick in the freezer, we had to seed a few more colonies from a June 1st transformation of the brick, in LB.
| |
| - |
| |
| - | ===July 5===
| |
| - | *I5610 seeding from yesterday were diluted 20X in supplemented MM and grown to an OD of 0.2-0.3 for imaging. Upon investigation under the microscope, no florescence was present under the new YFP filter thus again, the represillator appears to be inactive.
| |
| - | *J-brick from the old June 1st plates were again seeded in LB and grown overnght in the IS.
| |
| - |
| |
| - | ===July 6===
| |
| - | *Imaging on the MNI confocal was not successful because the sample kept drifting out of focus (or is it the microscope that can't keep focus?).
| |
| - | *Imaging on the 5th floor confocal also showed that the focus was changing under bright field. The sample was not showing any fluorescence, though (bad colony?).
| |
| - | *On Monday, we need to determine if it is the microscope or the sample that is causing the problem. We need some fixed bacterial slides to look at.
| |
| - | *Ordered Streptomycin, primers for the isolation of the I-insert and CcdB resistant cells from invitrogen. <br>
| |
| - | '''Cloning Strategy for I15004 in pSB1AK3'''
| |
| - |
| |
| - | <u>A. Vector Preparation</u>
| |
| - |
| |
| - | 1. Transform psb1AK3 in OneShot CcdB resistant cells
| |
| - |
| |
| - | 2. Plate on Streptomycin plates
| |
| - |
| |
| - | 3. Miniprep
| |
| - |
| |
| - | 4. Digest with EcoRI and PstI
| |
| - |
| |
| - | <u>B. Insert Preparation</u>
| |
| - |
| |
| - | 1. PCR I15004 gene with standar biobrick primers
| |
| - |
| |
| - | Primers: Forward: 5’ attaccgcctttgagtgagc 3’ | Reverse: 5’ tgccacctgacgtctaagaa 3’
| |
| - |
| |
| - | 2. PCR Purification
| |
| - |
| |
| - | 3. Digest with EcoRI and PstI
| |
| - |
| |
| - | <u>C. Ligation</u>
| |
| - |
| |
| - | 1. Prepare an insert:vector ratio of ~1:3
| |
| - |
| |
| - | 2. Perform Ligation
| |
| - |
| |
| - | <u>D. Transformation</u>
| |
| - |
| |
| - | 1. Into MC4100 cells (with J brick too)
| |
| - |
| |
| - | ===July 8===
| |
| - | Seeded 3 colonies of J40001 again from the same plate (June 1st, 100ul volume) in 1X LB and Amp.
| |
| - |
| |
| - | ===July 9===
| |
| - | *Transformation of J-brick from the biobrick plates into Top 10 cells. HS of 2 min with 3uL of DNA was conducted.
| |
| - | *Transformation of the I5610 from the biobrick DNA was also conducted into MC4100 cells in a final attempt to see florescence.
| |
| - |
| |
| - | ===July 10===
| |
| - | *Seeding of J40001 and I5610 was done.
| |
| - |
| |
| - | ===July 11===
| |
| - | *Miniprep of J40001 for use to make more I+J oscillating systems.
| |
| - | *Restriction Digest of the J brick was conducted with EcoRI and PstI and its presence was confirmed
| |
| - | *A PCR was also conducted (as per Elvis' protocol) in attempt to amplify the I15004 insert from the standard primers ordered from MIT. The protocol appears in the protocol section.
| |
| - | *ccdB cells arrived for the tranformation of the new pSB1AK3 plasmid and these were diluted to 100mL in preparation for the chemically competent cells proceedure tomorrow.
| |
| - |
| |
| - | ===July 12===
| |
| - | *Chemically competent cells were made (following Annette's protocol) of the ccdB cells.
| |
| - | *Transformation of the pSB1AK3 plasmid into these cells was then preformed and plated on AMP/KAN plates. After grown overnight, there was only a single colony indicating that the home-made cells were indeed incompetent or the transformation was bad. A new protocol specific for the transformation of ccdB cells was found and utilized the next day.
| |
| - | *A PCR purification was also preformed as found on openwetware (see protocol section again) and following a large-scale gel, no bands were present meaning that the insert was not amplified or simply lost during the purification step.
| |
| - |
| |
| - | ===July 13===
| |
| - | *pUC19 was transformed into the homemade cc ccdb cells to test the efficiency using the modified transformation protocol. Upon overnight growth, less then 5 colonies on two plates (each with 100uL of diluted solution) was presented so the competency of the cells has somewhere been compromised; thus, the commercial cells will be used from now on.
| |
| - | *A I+J transformation was also conducted and plated on amp/kan plates.
| |
| - | *The PCR was also repeated using Elvis' protocol though the apparently proper annealing temperature of 51 degrees was used.
| |
| - |
| |
| - | ===July 15===
| |
| - | *made AMP
| |
| - | *Amplyfied cc cells
| |
| - | *PCR I-brick
| |
| - |
| |
| - | PCR steps (IGEM)
| |
| - | 1.heat to 95 5 mins
| |
| - | 2.cool to 57 then 1 min pause
| |
| - | 3.heat to 72 then 1 min pause
| |
| - | 4. cycle again
| |
| - |
| |
| - | *I+J was transformed into MC cells
| |
| - | *pUC was transformed into ccDB cells used 2 different heat shocks time
| |
| - |
| |
| - | ===July 17===
| |
| - | * made LB and dH2O
| |
| - | *AMP-KAN plates were made. agarose was taken form 7th floor lab
| |
| - | * Ran a gel
| |
| - |
| |
| - | * I+J was also seeded in Supp.M.M for imaging
| |
| - | * pSB1AK3 was seeded in 1x LB
| |
| - | *I15004 was miniprepped for a large scale digest
| |
| - | An unexpected band was found at 1.2 kb
| |
| - |
| |
| - | ===July 19===
| |
| - | pSB1AK3 was miniprepped
| |
| - | I+J was imaged
| |
| - |
| |
| - | ===July 23===
| |
| - |
| |
| - | * Miniprepped I-brick
| |
| - | * Then it was digested with
| |
| - | a) Afe I, Pst
| |
| - |
| |
| - | b) Ban II, Xba I\
| |
| - |
| |
| - | * pSB1AC3 was transformed into ccdB cells
| |
| - | * I+J was seeded
| |
| - | * AMP-CAN and AMP-CAN-KAN plates were made
| |
| - |
| |
| - |
| |
| - | AMP: 1ul/ml
| |
| - | CAN: 0.8ul/ml
| |
| - | KAN: 5ul/ml
| |
| - |
| |
| - | ===July 28===
| |
| - |
| |
| - | *Test: Growth of J40001 in Kan to test the sensitivity to the opposite resistence. Results were obtained on the basis of the resulting OD when the J was grown in different concentrations of Kan
| |
| - | *5uL/mL OD: 0.917
| |
| - | *7.5uL/mL OD: 0.920
| |
| - | *10uL/mL OD: 0.838
| |
| - | *15uL/mL OD: 0.837
| |
| - | *20uL/mL OD: 0.782
| |
| - | *Based on these results, the higher the concentration of Kan, the lower the growth of J thus the highest concentration of KAN that is sensitive to the I brick should be used.
| |
| - |
| |
| - | Imaging: First samples seeded from yesterday were diluted in the morning each 10X and to 5mL of Minimal Media. The seedings were washed and pellets from two seedings were pooled into one sample and made up to two different concentrations (0.5mL and 1.5mL of final added supplemental minimal media). Further, dilute and concentrated samples were also made through growth in either DOX or AHL to test the reactivity of the system. The samples were placed in the plate reader for 18 hours and the data analyzed the next day.
| |
| - |
| |
| - | Note on AHL and DOX: AHL stock contains 10 000X concentration which must be diluted by 10X and then added to the solution as 1uL/mL. DOX stock allready exists as 1000X and thus can be added as 1uL/mL.
| |
| - |
| |
| - | Results suggest the DOX and AHL indeed have an effect on the flourescence. Oscillations inconclusive as any potential osciallations could be attributed to random noise. The dilute samples gave the expected results where the absolute value of the DOX was lower then the control (I+J) and the AHL was higher. Interestingly though, the concentrated sample had opposite results. The concentrated DOX showed increased flourescence whereas the concentrated AHL showed decreased flourescence possibly from the sensitivity of the system to AI levels.
| |
| - |
| |
| - | ===July 30===
| |
| - | After a meeting with the theory people, a new approach is to be taken with the project. A new I brick has been ordered that should have the proper sequence as well as an addition with a consitutive promoter with the LuxR to eliminate the cross-talk of the pTet promoter of the current LuxR and the repressilator system. This new insert shall be ligated into a medium-copy number plasmid pSB1AK3.
| |
| - |
| |
| - | Also, a series of news transformation are to be carried out to try to repeat the oscillations from last year. The I5610 repressilator and the I+J system are both to be put into BL21 cells (which contain an endogenous Lac) as was done in the previous year. As a control, these two systems shall be transformed into the MC4100 cells as has been many times before. Also, the other repressilators, I5611 and I5612, are to be amplified in Top10 to test the bands for them and to see if the correct DNA is indeed present (as the I5610 is deemed to not be correct). Lastly, E0434 and J0445 are to be amplified in Top10 as well as these contain YFP and RFP respectively and can be placed on the I5611 repressilator as an assay as this repressilator does not have it. As for the transformations, all were done with 5uL of DNA and with the following heat shock times: 2 minutes for Top10, 45s for MC4100 and 2 minutes for BL21.
| |
| - |
| |
| - | The results proved to be decent with the following colony growth:
| |
| - | *15611 in top10 dozen good colonies
| |
| - | *I5612 in top10 2 decent colonies
| |
| - | *I5610 in BL21 dozen good colonies
| |
| - | *15610 in MC4100 6 good colonies
| |
| - | *I+J in BL21 2 large strange colonies
| |
| - | *I+J in MC4100 no colonies
| |
| - | *E0434 in top10 about 50 great colonies
| |
| - | *J0445 in top 10 about 25 great colonies
| |
| - |
| |
| - | ===July 31===
| |
| - | *First, a large-scale restriction digest is to be implemented on the pSB1AK3 with both EcoRI with PstI and XbaI with SpeI (simply as digests have not been terribly successful this year. The plasmid was digested as to prepare it for the arriving I brick from the the sequencing company. The digest was run for 2hours 45 minutes and run on a gel for 80 minutes.
| |
| - |
| |
| - | *A series of seeding were also preformed to test the sensitivity of the I and J bricks to the antibiotics.
| |
| - | *I in Kan (5, 7.5, 10, 20, 50uL/mL)
| |
| - | *J in Kan (5, 7.5, 10, 20, 50uL/mL)
| |
| - | *I in Amp (1, 2, 5, 10, 20 uL/mL)
| |
| - | *J in Amp (1, 2, 5, 10, 20 uL/mL)
| |
| - |
| |
| - | *Seedings of the successful transformations were also done in minimal media or LB depending on whether amplification or imaging was to be done (all I+J and I5610 were in minimal media and the rest in LB)
| |
</td></tr>
May 2007
May 11
Autoclaved LB, Agar and Minimal Medium. Made plates with AmpR, KanR and both Amp and Kan. Concentrations used (same for cell cultures):
- Amp: 1uL/mL
- Kan: 10uL/mL
- Cam: 0.8uL/mL (from Elvis' aliquots)
The receipe for M9 Minimal Medium is in my lab notebook which is in the lab so I'll post it later under the Protocols section. Hopefully we can get the 2007 wiki soon. Horia
May 14
Moved plates from iGEM fridge to fridge on C block (end of hall) Made 100X Yeast extract and 10X Dextrose (for supplementing minimal medium) Prepared CaCl2 and CaCl2/Glycerol 10% solutions for CC procedure of tomorrow Will seed tonight. Horia
May 15
Performed cc procedure with top10 (elvis' home made), bl21 a1 and stble3
Performed seeding procedure on plates from last year: ILS004, duplicate copies of 5mL LB with 50uL KAN;
RSE/J40001, duplicate copies of 5mL LB with 5uL AMP;
Place in IS overnight
May 16
Transformed cc cells with pUC19 and plated
Repeated seeding procedure as that from previous day did not prove any results (defective shaker?). Both ILS004 and RSE repeated in triplicate with its respective antibiotic. Placed in IS at noon and two samples diluted with LB (100mL to RSE sample and 80mL to ILS004) and placed in the IS overnight. No cell growth.
May 17
Nothing grew on most of the plates. Only 2 colonies on a stble3 plate. Decided the cells were bad because 1. we did not keep them on ice while we transported them etc. and 2. some cells waited a long time on ice because we had to do sequential centrifugations (not enough of one kind of tube).
Removed from incubator at night and placed in the fridge.
Susan, Avi and Jimmy seeded cells again for Friday. BL21, Top10 and STBLE3 repeated in triplicate in 5mL LB and placed in SI overnight.
May 18
Performed cc procedure.
May 22
Made LB for Seeding procedure from 15.5g of solid LB to 500ml of water - x3.
Performed transformation of competent cells with PGFP (which was supposed to be pUC19) (Top 10 and Stble 3) and BL21 with PGFP and Amp antibiotic to validate their quality.
For the transformation procedure, used LB instead of S.O.C. Medium, due to its unavailability, then spread the cells on Agar gel plates with Amp and LB and placed in incubator overnight.
Made some additional Agar gel plates with Amp, which were kept in the freezer for future use.
May 23
Test transformation results
BL21
30s / 2 min Heat Shock
20 µl = 0 cells / many cells
75 µl = 0 cells / many cells
Top 10
30s / 2 min Heat Shock
20 µl = many cells / many cells
75 µl = many cells / many cells
Stable 3
30s / 2 min Heat Shock
20 µl = ~ 30 cells / 7 cells
75 µl = ~ 30 cells / 3 cells
Then performed transformation using Top 10 cells. Added biobrick (10M well) with Kan plates (200µl & 50µl) and RSE with Amp plates (100µl & 20µl). Left in incubator overnight at 37C.
Also, six seeding were preformed on test colonies transfected with PGFP and let in the IS overnight.
May 24
Miniprep protocol (from iGEM 2006) of Top10 and STBLE3 cells transformed with pGFP plasmids and seeded yesterday. BL21 cells were tested for the presence of the pGFP plasmid through microscope examination which proved positive results.
A restriction digest was implemented on the isolated DNA from the Top10 and STBLE3 cells
1.5uL Buffer 2
0.5uL of BSA
3uL DNA
8uL water
1uL EcoRI
1uL XbaI
Due to lack of ethidium bromide, a gel could not be made so the run was postponed for Friday.
May 25
First, the Top10 and STBLE3 were again digested as per the digestion above to be run in parallel with the digestion from yesterday.
An electrophoresis gel was made
50mL of TAE
0.35g agarose
heated ~20s then cooled to <60 degrees Celsius
7uL of ethidium bromide was added and poured into a gel plate
1.74uL of 10X loading dye was added to the DNA and the gel was run for 45 minutes at 100V; upon completion, a picture was taken to reveal no bands.
A miniprep was also preformed on the iBrick (Il5004 plasmid) and RSE cells (J40001 plasmid) seeded the day before and DNA stored in the freezer.
May 28
Today, a restriction digest was preformed on the iBrick and RSE cells with the following respective solutions in duplicate
IL5004
1.5uL Buffer 3
0.5uL BSA
3uL DNA
1uL PvuII
1uL PstI
8uL water
J40001
1.5uL Buffer 3
0.5uL BSA
3uL DNA
1uL EcoRV
1uL PstI
8uL water
Again, a gel was run and again, a negative result was obtained showing no bands.
May 30
Midi prep of iBrick with a new midi prep kit.
Seeding of J-brick (RSE) and Jay's pEGFP and pTet
May 31
A gel was run with the following wells.
- I-brick from yesterday's midi prep
- I-brick from yesterday's midid prep (2)
- RSEI
- RSE2
- pEGFP mini prepped
- pTet mini prepped
- Elvis's pGFP
The gel from yesterday's midi prep was successful and DNA was present.
Dilutions where implemented on the seedings from yesterday
