Alberta/Calender/October

From 2007.igem.org

< Alberta | Calender(Difference between revisions)

Latest revision as of 01:45, 27 October 2007

October 2007
Su	M	Tu	W	Th	F	Sa
	1	2	3	4	5	6
7	8	9	10	11	12	13
14	15	16	17	18	19	20
21	22	23	24	25	26	27
28	29	30	31

To September 2007
To November 2007
Back to UofA iGEM Home

== October 1 ==
JG
Miniprep J61003+Enny and Benny+J61003
Minis are in -20

ML
Brought the tubes labelled "sequencing rxns" up to MBSU
Also brought some XBA 1 from fermentas freezer since we ran out
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min
Colony O/N of I0500/ J61003 and Buddy/J61003

@@ Line 81: / Line 81: @@
 == October 1 == <br>
+JG<br>
+Miniprep J61003+Enny and Benny+J61003<br>
+Minis are in -20<br><br>
+ML<br>
+Brought the tubes labelled "sequencing rxns" up to MBSU<br>
+Also brought some XBA 1 from fermentas freezer since we ran out<br>
+Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br>
+Colony O/N of I0500/ J61003 and Buddy/J61003<br>
-CZ - 2:30pm
@@ Line 90: / Line 98: @@
 == October 2 ==
+VH-1PM<br>
+No Kan plates therefore made kan plates<br>
+On COuntertop<br>
+Miniprepped ML's overnights from OCt 1<br>
+Lysis solution is a no go<br>
+Started new O/N of previows overnights for tomorrow<br>
+No more LB<br>
+WM is Wayne Materi (a team advisor) in the following.
+WM-
+Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.
+We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase).  After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.
+Digest I725021/SpeI+PstI and gel purify ~3kb band
+Digest I725022/SpeI+PstI and gel purify ~1.2kb band
+Ligate  (Got 16 colonies vs. 10 for negative ctl).
 [[Alberta/Calender/October#October|to the top]]
@@ Line 97: / Line 122: @@
 MC - 800hrs <br>
-CZ - 2:30pm <br>
+Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br>
+Transform THolase into XL10 gold plates<br>
+Miniprep of 10500+J61003 O/N<br>
+ML<br>
+Digest of 10500+J61003 with ECORI and XBA<br>
+Housekeeping complete<br>
+Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br>
+CZ - 7:00pm<br>
+Ran gel of I0500/J61003<br>
+It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br>
 <b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br>
@@ Line 105: / Line 140: @@
 == October 4 ==
+NK - 930<br>
+VH - 2pm<br>
+Cleaned up 37 degree<br>
+Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br>
+Disposed of really disgusting plates<br>
+Got ride of I0500 ovrnights that hve been on shaker for a wek now<br>
+CHecke thoolase kan plates<br>
+Showing blue dots so far and af we white doets<br>
+Left plates in 37 celsious room<br><br>
+JP<br>
+Sequencing of 3 primer of DBS<br>
+Ligate I0500 eco/spe into J61003 (eco/xba)<br>
+WM - Primers for colony PCR and sequencing are as follows: <br>
+Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br>
+Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br>
+Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br>
+Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br>
+Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br>
+VF and VR as per BioBricks <br>
+<br>
+Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br>
+<br>
+Expect
+[[Image:UVP00153annot.jpg]]<br>
+<br>
+Colonies 1 and 8 look good.  Sequence with Primer 1. <br>
@@ Line 113: / Line 175: @@
 == October 5 ==
+JG/MC - 800hrs <br>
+Ran gel of i0500 and buddy<br>
+Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br>
+Ran gel of I0500J61003 eco/xba<br><br>
+ML<br>
+Gel completd and took photos<br>
+Buddy and I0500 digested<br>
+Extracted gel<br>
+Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br>
+CZ - Sorry I can't make it for personal reasons.
+WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.
+Also ran a verifying digest on BuOP1 O/Ns
+BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)
+[[Image:UVP00157annot.jpg]]
+BuOP1.1 and .8 both look good.
 [[Alberta/Calender/October#October|to the top]]
@@ Line 120: / Line 202: @@
 == October 6 ==
+ED 9:00<br>
+Made a to do list for the day<br>
+NK 2pm<br>
+Ligations of I0500 purify oct 5 and J61003<br>
+Left on bench with green tape labelled "ligations oct6"<br>
+Digest Boo34 with s,p<br>
+Digests in freezer labelled "digestions B0034 S,P"<br>
+WM - Make BuOP2 by inserting I725023 into BuOP1
+Digests:  BuOP1/SpeI+PstI (gel purify ~3.8kb band)
+          I725023/XbaI+PstI (gel purify ~850bp band - already have)
+[[Image:UVP00158annot.jpg]]
+Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp
 [[Alberta/Calender/October#October|to the top]]
@@ Line 126: / Line 224: @@
 == October 7 ==
+ED 9:00
+NG 12:00
+WM - did 8 O/Ns and minipreps
+Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)
+[[Image:UVP00160annot.jpg]]
+All but 4 and 8 look good.  Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2
 [[Alberta/Calender/October#October|to the top]]
@@ Line 133: / Line 240: @@
 == October 8 ==
+WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.
@@ Line 139: / Line 246: @@
 == October 9 ==
+NK<br>
+Loaded gel with digets from october 6, boo34 S,P<br>
+Put the ligations from oct6 in the freezer with the tape in tray #3<br>
+VH<br>
+Gel extrations B0034 sp1 and boo34 sp2<br>
@@ Line 147: / Line 257: @@
 == October 10 ==
+JP?<br>
+Tholase PCR<br><br>
+MC<br>
+Ligated Buddy oct 5 into Boo34 digest oct 6<br>
+Left on bench<br>
+WM - Make BuOP3 by inserting I725024 into BuOP2
+Digests:  BuOP2/SpeI+PstI (expect 5047bp -> gel purify)
+          I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown
+[[Image:UVP00161annot.jpg]]
+Cutout all four bands and gel purify.
+I725024 was digested and gel-purified seperately.
+Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.
+Ligations (fast tracking construction).  Plate 150ul on LB+Amp
 [[Alberta/Calender/October#October|to the top]]
 == October 11 ==
+JP?<br>
+PCR thiolase<br>
+Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates
+WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).
+[[Image:UVP00165annot.jpg]]
+Didn't work very well.  Try confirming by digest.
 [[Alberta/Calender/October#October|to the top]]
@@ Line 160: / Line 293: @@
 == October 12 ==
+MC, JG @ 800hrs<br>
+Ran gel of PCR products<br>
+No growth on the buddy in Boo transformation<br>
+Religations of buddy into boo but couldnt find Buddy therefore religations halted
+WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)
+[[Image:UVP00166annot.jpg]]
+Sequence 1, 4, 5, 6 with Primer 3 to confirm
 [[Alberta/Calender/October#October|to the top]]
 == October 13 ==
+ML<br>
+Religated buddy and Boo<br>
+Note: when free of tasks work on poster, or presentation or wiki or call justin or erin
+WM - BuOP3.4 and 3.5 sequenced good.  Due to time considerations we will call BuOP3.4 part I725099 and submit this.
@@ Line 171: / Line 317: @@
 == October 14 ==
+JG, MC<br>
+Retransform Buddy and Boo34<br>
+Transform tholase<br><br>
+JP<br>
+Restriction of thiolase with ECO/PST<br>
+Ran gel<br>
+Transform rom Bud "2" oct 12<br>
@@ Line 177: / Line 332: @@
 == October 15 ==
+Re-digestions for re-ligations of boo34 and buddy<br>
+Digest boo34 s/p<br>
+Ran gel<br>
+Extract tholase from oct 14 into tube labelled "THiolase band EX"<br>
+Updated wiki<br><br>
+To do:<br>
+Extract gel<br>
+Ligate with buddy<br>
+Run ligation on gel<br>
+Extract<br>
+Transform<br>
 [[Alberta/Calender/October#October|to the top]]
@@ Line 184: / Line 349: @@
 == October 16 ==
+NK- Digested B0034 with Spe and PST.
+-Ran a gel of restriction
+-Extracted Thiolase from gel on previous day.
+VH and AL - Took a picture of gel
+-Cut out and purified four bands of B0034 from previous digestion
+JP- Ligate B0034 with Buddy
+WM - Verifying I725025 a.k.a. Buddy in Boo)
+The ligation and transformation already seem to have been done and produced many colonies.  So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.
+[[Image:UVP00169annot.jpg]]
+All 16 colonies tested look good.  Setup 12 O/Ns to verify by digest.
@@ Line 189: / Line 372: @@
 == October 17 ==
+WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)
+[[Image:UVP00170annot.jpg]]
+All looked good.  Sequence 1, 2, 9, 10.
@@ Line 196: / Line 386: @@
 == October 18 ==
+VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates
+WM - I725025 sequences all good.  Use #1.
 [[Alberta/Calender/October#October|to the top]]
@@ Line 219: / Line 411: @@
 == October 22 ==
+I'll be there at 3-NK
+ML - Gel purified Boo-Thiolase
+-Digested B0034 with ECO and PST
+-Ligated Thiolase with B0034
+WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.
+Arabinose promoter (+AraC repressor) comes frmo I0500.
+Digests:
+         I725021/EcoRI+XbaI
+         I725022/EcoRI+XbaI
+         I725023/EcoRI+XbaI
+         I725024/EcoRI+XbaI
+         I725025/EcoRI+XbaI
+         I0500/EcoRI+SpeI
+[[Image:UVP00173annot.jpg]]
+Note: I0500 concentration is quite low.  Probably need to grow it up O/N then induce O/N with IPTG after that.
+Setup ligations anyway.
 [[Alberta/Calender/October#October|to the top]]
@@ Line 226: / Line 441: @@
 == October 23 ==
+AL and NK - Transformed B0034 and Thiolase into XL10 Gold Cells.
+WM - very few colonies from ligation
+Did 1 O/N from each kind of ligation/transformation for digest verification.
@@ Line 232: / Line 451: @@
 == October 24 ==
+WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025
+Digest with /XbaI+SpeI
+Expected sizes (in addition to common 2149bp band):
+           I725021 - 2100bp
+           I725022 - 2400bp
+           I725024 - 3839bp
+           I725025 - 2435bp
+[[Image:UVP00175annot.jpg]]
+First and last ligation looked like they worked.  We will try to do this again.
@@ Line 244: / Line 475: @@
 == October 26 ==
+Many thiolase in B0034 colonies. Started overnights for mini and digests tomorrow.
+jp-

Views

Personal tools

Alberta/Calender/October

From 2007.igem.org

Latest revision as of 01:45, 27 October 2007

Contents

October 2

October 4

October 5

October 6

October 7

October 8

October 9

October 10

October 11

October 12

October 13

October 14

October 15

October 16

October 17

October 18

October 19

October 20

October 21

October 22

October 23

October 24

October 25

October 26

October 27

October 28

October 29

October 30