1ORE-CYCtata
From 2007.igem.org
(Difference between revisions)
| (3 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| - | 1ORE-CYCtata is long | + | 1ORE-CYCtata is 300bp long and this is its sequence: |
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca | ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca | ||
| Line 7: | Line 7: | ||
[[Image:1ore promoter .jpg]] | [[Image:1ore promoter .jpg]] | ||
| - | In this photo you can see the result of our PCR.Our | + | |
| + | In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker | ||
Latest revision as of 16:50, 25 October 2007
1ORE-CYCtata is 300bp long and this is its sequence:
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker
