1ORE-CYCtata
From 2007.igem.org
(Difference between revisions)
(One intermediate revision not shown) | |||
Line 8: | Line 8: | ||
[[Image:1ore promoter .jpg]] | [[Image:1ore promoter .jpg]] | ||
- | In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level | + | In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker |
Latest revision as of 16:50, 25 October 2007
1ORE-CYCtata is 300bp long and this is its sequence:
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker