Paris/July 27

From 2007.igem.org

(Difference between revisions)
(→Ligations)
(→Ligations)
Line 74: Line 74:
|
|
|without ligase in the mix: control of digestion efficiency
|without ligase in the mix: control of digestion efficiency
 +
|- style="background: #cccccc;" 
 +
| style="background: #ccffcc;" |Control 3
 +
|
 +
|
 +
|D9.2 (J61002 ready for insertion of a FI)
 +
|2µl
 +
|control of D9.2 digestion
 +
|- style="background: #cccccc;" 
 +
| style="background: #ccffcc;" |Control 3
 +
|
 +
|
 +
|D15.2 (B0030 BV)
 +
|2µl
 +
|control of D15.2 digestion
 +
|- style="background: #cccccc;" 
 +
| style="background: #ccffcc;" |Control 3
 +
|
 +
|
 +
|D22.1 (pSB1A2 Eco, Pst)
 +
|2µl
 +
|control of D22.1 digestion
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   
| style="background: #ccffcc;" |L1
| style="background: #ccffcc;" |L1
|D23.1 (AraC/pBad promoter FI)
|D23.1 (AraC/pBad promoter FI)
-
|8.5
+
|8
|D9.1 (J61002 ready for insertion of a FI)
|D9.1 (J61002 ready for insertion of a FI)
-
|1.5
+
|2
|construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad)
|construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad)
|- style="background: #cccccc;"   
|- style="background: #cccccc;"   

Revision as of 17:21, 27 July 2007

Contents

PCR to perform

Perform the following PCR reactions

  • P5 (then perform digestion rxn D18 & D20)
  • P6 (then perform digestion reactions D19 & D21)
  • P8
  • P9

Repeat ligation reactions (same as 25/07/07). Also include digestion products D28 & D32


Oligo design for Wanner deletion

We were for now on not able to perform the deletion of DapA through transduction. So we will try the deletion through the Wanner method. We will also attempt the deletion of FtsZ.

We will use the protocol of the keio collection: [http://ecoli.naist.jp/gb6/Resources/deletion/Del_construct.html]

  • 20nt of upstream region of kan gene,

5'-ATTCCGGGGATCCGTCGACC-3' (P1)

  • 20nt of kan downstream sequence,

5'-TGTAGGCTGGAGCTGCTTCG-3' (P2)

DapA deletion

  • 50nt DapA upstream region

5'-CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATG-3' (P3)

  • 50nt DapA downstream region (reverse complement)

5'-AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGC-3' (P4)

  • dDapA-F

CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATGATTCCGGGGATCCGTCGACC (P3 + P1)

  • dDapA-R

AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)

FtsZ deletion

  • 50nt FtsZ upstream region

5'-GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATG-3' (P5)

  • 50nt FtsZ downstream region (reverse complement)

5'-GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGC-3' (P6)

  • dFtsZ-F

GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATGATTCCGGGGATCCGTCGACC (P5 + P1)

  • dFtsZ-R

GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)


Ligations

Ligations
Number Insert Insert Volume (µL) Vector Vector Volume (µL) Comments
Control 1 MP3.1 digested with EcoRI control of ligation efficiency
Control 2 MP3.1 digested with EcoRI without ligase in the mix: control of digestion efficiency
Control 3 D9.2 (J61002 ready for insertion of a FI) 2µl control of D9.2 digestion
Control 3 D15.2 (B0030 BV) 2µl control of D15.2 digestion
Control 3 D22.1 (pSB1A2 Eco, Pst) 2µl control of D22.1 digestion
L1 D23.1 (AraC/pBad promoter FI) 8 D9.1 (J61002 ready for insertion of a FI) 2 construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad)
L6 D14.1 (Cre ORF) 8 D15.1 (B0030 BV) 2 construction of the biobrick strong RBS(B0030)-Cre ORF
L9 lox66 [O14+O15] (0.2µM) 2 D22.1 (pSB1A2 Eco, Pst) 2 (+6 H2O) lox66 cloned as a biobrick in pSB1A2
L10 lox71 [O16+O17] (0.2µM) 2 D22.1 (pSB1A2 Eco, Pst) 2 (+6 H2O) lox71 cloned as a biobrick

Ligation mix:

  • 2µl TP
  • 1µl Ligase
  • 7µl H20

Reaction in 20µl

ON @ 4°C

Retrieved from "http://2007.igem.org/wiki/index.php/Paris/July_27"