Paris/July 27
From 2007.igem.org
Eismoustique (Talk | contribs) (→Ligations) |
Eismoustique (Talk | contribs) (→Ligations) |
||
Line 52: | Line 52: | ||
|- style="background: #ccccff; text-align: center;" | |- style="background: #ccccff; text-align: center;" | ||
|width=5%| Number | |width=5%| Number | ||
- | |width= | + | |width=20%| Insert |
|width=5%| Insert Volume (µL) | |width=5%| Insert Volume (µL) | ||
|width=25%| Vector | |width=25%| Vector | ||
|width=5%| Vector Volume (µL) | |width=5%| Vector Volume (µL) | ||
- | |width= | + | |width=35%| Comments |
|width=5%| Number of colonies | |width=5%| Number of colonies | ||
|- style="background: #cccccc;" | |- style="background: #cccccc;" |
Revision as of 14:16, 30 July 2007
Contents |
PCR to perform
The following PCR reactions have been performed
- P5
- P6
- P8
- P9
Oligo design for Wanner deletion
We were for now on not able to perform the deletion of DapA through transduction. So we will try the deletion through the Wanner method. We will also attempt the deletion of FtsZ.
We will use the protocol of the keio collection: [http://ecoli.naist.jp/gb6/Resources/deletion/Del_construct.html]
- 20nt of upstream region of kan gene,
5'-ATTCCGGGGATCCGTCGACC-3' (P1)
- 20nt of kan downstream sequence,
5'-TGTAGGCTGGAGCTGCTTCG-3' (P2)
DapA deletion
- 50nt DapA upstream region
5'-CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATG-3' (P3)
- 50nt DapA downstream region (reverse complement)
5'-AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGC-3' (P4)
- dDapA-F
CATACCAAACGTACCATTGAGACACTTGTTTGCACAGAGGATGGCCCATGATTCCGGGGATCCGTCGACC (P3 + P1)
- dDapA-R
AAGCCATCAAATCTCCCTAAACTTTACAGCAAACCGGCATGCTTAAGCGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)
FtsZ deletion
- 50nt FtsZ upstream region
5'-GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATG-3' (P5)
- 50nt FtsZ downstream region (reverse complement)
5'-GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGC-3' (P6)
- dFtsZ-F
GACGATGATTACGGCCTCAGGCGACAGGCACAAATCGGAGAGAAACTATGATTCCGGGGATCCGTCGACC (P5 + P1)
- dFtsZ-R
GAAACCCAAATTCCAGTCAATTCTTAATCAGCTTGCTTACGCAGGAATGCTGTAGGCTGGAGCTGCTTCG (P6 + P2)
Ligations
Ligations | ||||||
---|---|---|---|---|---|---|
Number | Insert | Insert Volume (µL) | Vector | Vector Volume (µL) | Comments | Number of colonies |
Control 0 | pUC19 | control of transformation efficiency | 4 | |||
Control 1 | MP3.1 digested with EcoRI (D0) | 2 | control of ligation efficiency | ~80 | ||
Control 2 | MP3.1 digested with EcoRI (D0) | 2 | without ligase in the mix: control of digestion efficiency | 0 | ||
Control 3 | D9.1 (J61002 ready for insertion of a FI) | 2µl | control of D9.2 digestion | 6 | ||
Control 4 | D15.1 (B0030 BV) | 2µl | control of D15.2 digestion | 1 | ||
Control 5 | D22.2 (pSB1A2 Eco, Pst) | 2µl | control of D22.1 digestion | 0 | ||
L1 | D23.2 (AraC/pBad promoter FI) | 8 | D9.1 (J61002 ready for insertion of a FI) | 2 | construct with pBad promotor regulating expression of mRFP (in order to test activity of pBad) | 12 |
L6 | D14.2(Cre ORF) | 8 | D15.1 (B0030 BV) | 2 | construction of the biobrick strong RBS(B0030)-Cre ORF | ~150 |
L9 | lox66 [O14+O15] (0.2µM) | 2 | D22.2 (pSB1A2 Eco, Pst) | 2 (+6 H2O) | lox66 cloned as a biobrick in pSB1A2 | 0 |
L10 | lox71 [O16+O17] (0.2µM) | 2 | D22.2 (pSB1A2 Eco, Pst) | 2 (+6 H2O) | lox71 cloned as a biobrick | 0 |
Ligation mix:
- 2µl TP
- 1µl Ligase
- 7µl H20
Reaction in 20µl
ON @ 4°C
Minipreps
minipreps were performed on the following ON cultures:
cultures of different clones of the ligation reactions of 25/07/07
- L1.2 & L1.3
- L2.1 & L2.2
- L9
- L10
- L6.1, L6.2 & L6.3
for more detail on these ligation reactions, go to 25/07/07
no glycerol stocks of hese strains have been generated yet (the culyures are launched tonight in order to do this)
minipreps & glycerol stocks:
- MP12.1 & MP12.2 (2 clones after transformation with biobrick BBa_P1003)