1ORE-CYCtata
From 2007.igem.org
(Difference between revisions)
| Line 1: | Line 1: | ||
| - | 1ORE-CYCtata is long | + | 1ORE-CYCtata is 300bp long and this is its sequence: |
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca | ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca | ||
| Line 8: | Line 8: | ||
[[Image:1ore promoter .jpg]] | [[Image:1ore promoter .jpg]] | ||
| - | In this photo you can see the result of our PCR.Our | + | In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level the band of the 0.5Kb Dna Marker |
Revision as of 16:49, 25 October 2007
1ORE-CYCtata is 300bp long and this is its sequence:
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level the band of the 0.5Kb Dna Marker
