Arthur Yu Notebook

From 2007.igem.org

(Difference between revisions)
Line 3: Line 3:
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br>
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br>
----
----
 +
==6/15 digestion party==
 +
* Good D1, D4
 +
* synthy plasmid thingy...
 +
  # [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L
 +
  # [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S
 +
* I716003a (pBca9145- cmr cass+rbs+neuS)
 +
  # [digest] pBca9145-neuS (I716001)      (BglII, XhoI; 2063+1245; S)
 +
  # [digest] pBca1101-I716051              (BamHI, XhoI; 3119+ 850; L)
 +
* pBca9145-yfbE_pro-rbs-RFP (I716004)
 +
  # [digest] pBca9145-yfbE_promote (I716002)    (EcoRI/BamHI, 2063+ 421, S)
 +
  # [digest] pBca1100-Bca1109                    (EcoRI/BamHI, 2927+1253, L)
 +
* wbbL
 +
  # miniprep'd and ready to go!
 +
  # [IMAGE] of gel
 +
  # Sent E1 and E2 for sequencing, forward (ay014, ay015)
 +
<br><br>
 +
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br>
 +
I did 10 digestions today. I'm proud of myself.
==6/14 stuff about things==
==6/14 stuff about things==
* neuS clone C1: WE HAVE A WINNER!
* neuS clone C1: WE HAVE A WINNER!

Revision as of 23:40, 15 June 2007

My Construction Files
My Sequencing Files

6/15 digestion party

  • Good D1, D4
  • synthy plasmid thingy... 
 # [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L
 # [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S
  • I716003a (pBca9145- cmr cass+rbs+neuS) 
 # [digest] pBca9145-neuS (I716001)       (BglII, XhoI; 2063+1245; S)
 # [digest] pBca1101-I716051              (BamHI, XhoI; 3119+ 850; L)
  • pBca9145-yfbE_pro-rbs-RFP (I716004) 
 # [digest] pBca9145-yfbE_promote (I716002)     (EcoRI/BamHI, 2063+ 421, S)
 # [digest] pBca1100-Bca1109                    (EcoRI/BamHI, 2927+1253, L)
  • wbbL 
 # miniprep'd and ready to go!
 # [IMAGE] of gel
 # Sent E1 and E2 for sequencing, forward (ay014, ay015)



NOtes: STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too
I did 10 digestions today. I'm proud of myself.

6/14 stuff about things

  • neuS clone C1: WE HAVE A WINNER!
  • miniprep party, D1/2/3/4
  • digestions didn't work too well mmmm going to sequence D1 and D4.
  • wbbL good plate, now incubating in shaker
  • cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)

6/13 gloves, zymo, and ethanol oh my

  • a random day
  1. neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked
  2. wbbL digest > new plate as well (old one had one colony and it was bad)
  3. yfbE put into shakey tubes
  • One of the neuS got miniprepped and the test digest looks good compared to test in ApE
061307 ayu gel1.jpg

  1. sending it for sequencing, eh.
  • Sequencing...
  1. Most (A1, A4, B1) sucked
  2. only A3 (HPI/katG) was decent. It might have an addition mutation of a G.
  3. A3 sent for reverse sequencing with G01001
  • Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)


Todo: Input parts in registry (yfbE?)

6/12 a bag full of grapes

  • YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE
  • PCR of yfbE...
  1. last night's thing, left in the freezer overnight. >FAIL<
  2. Did a new PCR -- looks good -- cells xform'd, plate is incubating.
  • neuS new xformation looks good. Three colonies now incubating.
  • wbbL (1) and HPI/katG (4)
  1. miniprepped and digest gel ran:
061207 ayu gel1.jpg

  1. HPI/katG 1,2,3,4 || wbbL || marker
  2. 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)
  3. decision to put 1,3,4,wbbL for sequencing.

Ayu 17:59, 12 June 2007 (EDT)

6/11 austin's birthday

  • CAKE PARTY - great custard cake
  • I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.
  • neuS failed; no colonies :(((((((
    • redid ligation and xformation. hopefully there will be good results tmrw!
  • made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week
  • researched nitric oxide (NO) and E. Coli - looks like soxRS is promising
  • also researched RBCs and how they deal with NO
  • plopped yfbE into PCR will do stuff with it tmrw


TO DO: enter yfbE into the registry
Ayu 18:24, 11 June 2007 (EDT)

6/8 long day?

  • My PCR from last night (HPI/katG) was ROXOR! (left)
    • xformed some DH10B's. w00t w00t
  • Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)
    • xformed DH10B's.
  • made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!
  • poured lotsa LB/agar+amp plates


060807 ayu gel1.jpg
060807 ayu gel2.jpg

6/7 we got benches

  • we got benches
  • pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]
  1. well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!
  • programmed pcr on machine upstairs (#6)
  • we got computers
  • AGAR SUX, for future reference:
  1. nuke @ 20:00 min, 50% power.
  2. water bath in tap water for 5-10 min
  3. thaw the antibiotic right now!!
  4. FIRE for disinfecting
  5. pour that stuff. set 15 min, then marker it then bag

6/6 waiting for oligos

  • Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106
  • We tried the P_tet/RFP triple/double digest to make a composite part.
  1. FAIL
  2. probably source DNA is bad
  3. so much for that activity...


Other stuff: I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"

6/5 coolbeans

  • Finalized oligos to order with Vai
  • Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)
  • Learned about the many composite part-making methods. Props 2 Chris
  1. prefix/suffix is weaksauce
  2. Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)
  3. DBBS
  4. 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad
  5. 1-2-3 method << 'Our Goal' in a few weeks. should be leet.
  • Planned and vicariously did the making of P_tet+RFP brick (see Vai Notebook)


Other Notes: All oligos are being ordered, w00t w00t. Ayu 18:36, 5 June 2007 (EDT)

6/4 Training Finishes, Real Stuff Starts

  • Incubated some colonies
  • Miniprep'd already-been-incubated colonies (2)
  • Double digest of the 2 minipreps + parent plasmid
  • Colony PCR'd the incubated E.coli
  • Ran gel of the digest + PCR
060407gelayu.jpg
  • >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>>
  • No bands for PCR or parent. Confused? Other ones look great.


As for me: Wiki acc works now.
Designing oligos and will compare with Vai. Ayu 18:19, 4 June 2007 (EDT)

to do

Retrieved from "http://2007.igem.org/wiki/index.php/Arthur_Yu_Notebook"