BerkiGEM2007-VaibhaviConstructionFile8
From 2007.igem.org
(Difference between revisions)
Line 4: | Line 4: | ||
PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp) | PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp) | ||
- | Digest pBca9145-Bca1090 | + | Digest pBca9145-Bca1090 (BsaI/BamHI, 989+1102, S) |
Product is I716258 | Product is I716258 | ||
Ligate with Part B | Ligate with Part B | ||
Line 13: | Line 13: | ||
PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp) | PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp) | ||
- | Digest pBca9145-I716253 | + | Digest pBca9145-I716253 (BsaI/BglII, 2512 + 777, L) |
Product is I716259 | Product is I716259 | ||
Ligate with Part A | Ligate with Part A |
Latest revision as of 20:25, 8 August 2007
Method Used: dBBS PCR ca1099F/G00101 on Part A (pBca9145-Bca1090) (553 bp) Digest pBca9145-Bca1090 (BsaI/BamHI, 989+1102, S) Product is I716258 Ligate with Part B ------------------------------------- ca1099F – ccaaaAGATCTatgaaacgttttagtctggc G00101 – gctagCTCGAGttaGGATCCttacttaattacaccacaggc PCR ca998/ca1099R on Part B (pBca9145-I716253) (3393 bp) Digest pBca9145-I716253 (BsaI/BglII, 2512 + 777, L) Product is I716259 Ligate with Part A ------------------------------------- ca998 – gtatcacgaggcagaatttcag ca1099R – gctgataaatctggagccgg Final product is I716260