From 2007.igem.org

Revision as of 08:29, 18 October 2007 (view source) Robertina (Talk | contribs) ← Older edit		Revision as of 08:34, 18 October 2007 (view source) Robertina (Talk | contribs) Newer edit →
Line 5:		Line 5:
	cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca		cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca
-	[[PCR]] 1ore promoter
	[[Image:1ore promoter .jpg]]		[[Image:1ore promoter .jpg]]
		+	In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb

---

Revision as of 08:34, 18 October 2007

1ORE-CYCtata is long 300pb and this is it's sequence:

ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca

In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb