1ORE-CYCtata
From 2007.igem.org
(Difference between revisions)
| Line 7: | Line 7: | ||
[[Image:1ore promoter .jpg]] | [[Image:1ore promoter .jpg]] | ||
| + | |||
In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb | In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb | ||
Revision as of 08:34, 18 October 2007
1ORE-CYCtata is long 300pb and this is it's sequence:
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca
In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb
