Alberta/Calender/October

From 2007.igem.org

(Difference between revisions)
(October 6)
(October 5)
Line 188: Line 188:
CZ - Sorry I can't make it for personal reasons.
CZ - Sorry I can't make it for personal reasons.
-
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816
+
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.
 +
 
 +
Also ran a verifying digest on BuOP1 O/Ns
 +
 
 +
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)
 +
 
 +
[[Image:UVP00157annot.jpg]]
 +
 
 +
BuOP1.1 and .8 both look good.
[[Alberta/Calender/October#October|to the top]]
[[Alberta/Calender/October#October|to the top]]

Revision as of 16:19, 24 October 2007

October 2007
Su M Tu W Th F Sa
1 2 3 4 5 6
7 8 9 10 11 12 13
14 15 16 17 18 19 20
21 22 23 24 25 26 27
28 29 30 31


To September 2007
To November 2007
Back to UofA iGEM Home

== October 1 ==
JG
Miniprep J61003+Enny and Benny+J61003
Minis are in -20

ML
Brought the tubes labelled "sequencing rxns" up to MBSU
Also brought some XBA 1 from fermentas freezer since we ran out
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min
Colony O/N of I0500/ J61003 and Buddy/J61003



to the top

Contents

October 2

VH-1PM
No Kan plates therefore made kan plates
On COuntertop
Miniprepped ML's overnights from OCt 1
Lysis solution is a no go
Started new O/N of previows overnights for tomorrow
No more LB

WM is Wayne Materi (a team advisor) in the following.

WM- Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG. We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.

Digest I725021/SpeI+PstI and gel purify ~3kb band Digest I725022/SpeI+PstI and gel purify ~1.2kb band

Ligate (Got 16 colonies vs. 10 for negative ctl).

to the top

== October 3 ==

MC - 800hrs
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308
Transform THolase into XL10 gold plates
Miniprep of 10500+J61003 O/N

ML
Digest of 10500+J61003 with ECORI and XBA
Housekeeping complete
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"
CZ - 7:00pm
Ran gel of I0500/J61003
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin.

NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs


to the top

October 4

NK - 930
VH - 2pm
Cleaned up 37 degree
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge
Disposed of really disgusting plates
Got ride of I0500 ovrnights that hve been on shaker for a wek now
CHecke thoolase kan plates
Showing blue dots so far and af we white doets
Left plates in 37 celsious room

JP
Sequencing of 3 primer of DBS
Ligate I0500 eco/spe into J61003 (eco/xba)


WM - Primers for colony PCR and sequencing are as follows:
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC
VF and VR as per BioBricks

Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good)

Expect UVP00153annot.jpg

Colonies 1 and 8 look good. Sequence with Primer 1.


to the top

October 5

JG/MC - 800hrs
Ran gel of i0500 and buddy
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP
Ran gel of I0500J61003 eco/xba

ML
Gel completd and took photos
Buddy and I0500 digested
Extracted gel
Labelled I0500 purify Oct5 and Buddy Purify oct 5


CZ - Sorry I can't make it for personal reasons.

WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.

Also ran a verifying digest on BuOP1 O/Ns

BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)

UVP00157annot.jpg

BuOP1.1 and .8 both look good.

to the top

October 6

ED 9:00
Made a to do list for the day

NK 2pm
Ligations of I0500 purify oct 5 and J61003
Left on bench with green tape labelled "ligations oct6"
Digest Boo34 with s,p
Digests in freezer labelled "digestions B0034 S,P"

WM - Make BuOP2 by inserting I725022

to the top

October 7

ED 9:00

NG 12:00

to the top

October 8

to the top

October 9

NK
Loaded gel with digets from october 6, boo34 S,P
Put the ligations from oct6 in the freezer with the tape in tray #3

VH
Gel extrations B0034 sp1 and boo34 sp2


to the top

October 10

JP?
Tholase PCR

MC
Ligated Buddy oct 5 into Boo34 digest oct 6
Left on bench


to the top

October 11

JP?
PCR thiolase
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates

to the top

October 12

MC, JG @ 800hrs
Ran gel of PCR products
No growth on the buddy in Boo transformation
Religations of buddy into boo but couldnt find Buddy therefore religations halted

to the top

October 13

ML
Religated buddy and Boo
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin


to the top

October 14

JG, MC
Retransform Buddy and Boo34
Transform tholase

JP
Restriction of thiolase with ECO/PST
Ran gel
Transform rom Bud "2" oct 12



to the top

October 15

Re-digestions for re-ligations of boo34 and buddy
Digest boo34 s/p
Ran gel
Extract tholase from oct 14 into tube labelled "THiolase band EX"
Updated wiki

To do:
Extract gel
Ligate with buddy
Run ligation on gel
Extract
Transform

to the top

October 16

to the top

October 17

to the top

October 18

to the top

October 19

to the top

October 20

to the top

October 21

to the top

October 22

I'll be there at 3-NK


to the top

October 23

to the top

October 24

to the top

October 25

to the top

October 26

to the top

October 27

to the top

October 28

to the top

October 29

to the top

October 30

to the top


UofA iGEM Home
To September 2007
To November 2007