1ORE-CYCtata

From 2007.igem.org

(Difference between revisions)
Line 8: Line 8:
[[Image:1ore promoter .jpg]]
[[Image:1ore promoter .jpg]]
-
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level the band of the 0.5Kb Dna Marker
+
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the Dna Marker

Revision as of 16:50, 25 October 2007

1ORE-CYCtata is 300bp long and this is its sequence:

ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca


1ore promoter .jpg

In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the Dna Marker