ThpA

From 2007.igem.org

(Difference between revisions)
 
Line 1: Line 1:
PCR ThpA F/R on ThpA          (553bp, BglII/XhoI)<br>
PCR ThpA F/R on ThpA          (553bp, BglII/XhoI)<br>
-
Sub into PBca1144                  (BglII/XhoI, 2054+910,  L)<br>
+
Sub into pBca9145-Bca1144      (BglII/XhoI, 2054+910,  L)<br>
Product is pBca9145-BBa I716331      <br>
Product is pBca9145-BBa I716331      <br>
---------------------------------------------------------------------------------------------<br>
---------------------------------------------------------------------------------------------<br>

Latest revision as of 18:04, 2 July 2007

PCR ThpA F/R on ThpA (553bp, BglII/XhoI)
Sub into pBca9145-Bca1144 (BglII/XhoI, 2054+910, L)
Product is pBca9145-BBa I716331



ThpAF Forward BglII site anneals to ThpA cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg

ThpAR Reverse XhoI site anneals to ThpA anneals to XhoI cgcatctcgagtcaggtggcgaacgggccta