Nhu Nguyen Notebook
From 2007.igem.org
| Line 213: | Line 213: | ||
ThpA has been having some problems with sequencing because the sequences haven't been matching up very well. In order to fix this problem, I carried out the process of ligation again for ThpA. <br> | ThpA has been having some problems with sequencing because the sequences haven't been matching up very well. In order to fix this problem, I carried out the process of ligation again for ThpA. <br> | ||
| - | '''[[User:Nnguyen|Nnguyen]]''' | + | '''[[User:Nnguyen|Nnguyen]] 13:00, 16 July 2007 (EDT)''' |
---- | ---- | ||
Revision as of 17:00, 16 July 2007
My Construction Files
My Sequencing Files
Nnguyen 15:40, 25 June 2007 (EDT)
Today I came in and I started my tutorial on internal sites because I missed a week of work last week. I completed the tutorial, and I was given my task for the week. Chris gave me a template to work on. The gene is called Streptomyces chrysomallus. There are four genes of interest in the template, and I had to make oligos for these genes. I had to construct two oligos for each gene, a forward primer and a reverse primer. In order to construct the oligos, I used the enzymes BglII and XhoI. BglII was used for the forward primer and XhoI was used for the reverse primer. In 2 out 4 genes, there were internal sites which meant that I had to make additional oligos.For gene ThpA, EcoRI was within it and so I had to make a primer that would remove it. The sequence for EcoRI was gaattc, and I changed it to gagttc. gag and gaa both code for the same amino acid which is glutamic acid. XhoI was within gene ThpB, and again I had to make a primver that would remove the restriction enzyme.
The sequence for XhoI is ctcgag, and I changed it to cttgag. ctc and ctt both code for the same amino acid which is leucine. In order to remove XhoI from ThpB, I construct a forward primer and a reverse primer. The reverse primer is the complimentary side of the forward primer. Compared to the oligos that I constructed for the beginning and end of each gene, the primers used to remove XhoI do not have restriction enzymes on them. Compared to ThpB, ThpA only has 2 primers and not 4 primers because the EcoRI was very close to the beginning of the gene. Therefore, I incorporated EcoRI into the forward primer for the gene ThpA. In the end, I ended up with 10 oligos.
At the end of the day, Sam showed the high school students how to pour agar into plates, and we left the plates on the counter throughout the night.
Nnguyen 15:40, 26 June 2007 (EDT)
I came into work today and helped the other high school students a little bit with their project while I was waiting for my oligos to arrive. They have not arrived yet; however, in the meantime, Sam and Arthur showed us how to make LB Agar and LB Broth. We poured 500mL of water into each glass bottle. For LB Agar, we added 20g of agar powder, and for LB Broth, we added 12.5g of broth powder. After adding the right amount into the 500mL of water, we shook the bottle until the powder dissolved. After that, we put all the glass bottles in a tray, untwisted the cap so that when they're put in the machine, they wouldn't break due to high pressure, and we added water and tape the caps. After we finished with the preparations, we put the tray into the autoclave machine for 25 minutes; however, it is better to let it sit in there for awhile to let it cool down. The agar that was placed in the autoclave machine did not work because the previous person who used it did not reset. We took out the agar bottles and let the machine exhaust for a while, and then we put it back in the autoclave for 25 minutes. After it finished, we let it stayed in there for a while so it can cool down. After taking them out, we added antibiotics to the agar bottles. We added AMP (antibiotics) and CAM (antibiotics) to 3 of the agar bottles, and we shook it. In the other agar bottles, we only added AMP. After shaking the bottles, we waited until the bubbles disappear and then we started pouring them into plates. If there were bubbles left in the plate, we put the flame directly on the agar so the bubbles go away. The plates that consist of AMP, we marked it with the color red. The plates that consist of AMP and CAM, we marked it with blue and red.
Nnguyen 23:57, 26 June 2007 (EDT)
At around 2:00, the oligos that I ordered yesterday arrived. I added water to each tube because the primers came in a form of powder. On each tube, it tells how much powder it is in nanomol. I multiplied the number of nanomol by 10 and that was how much water I added. For example, I added 385 microL of water into nn001.
nn001: 38.5 nmol
nn002: 27.5 nmol
nn003: 29.0 nmol
nn004: 29.4 nmol
nn005: 37.7 nmol
nn006: 33.6 nmol
nn007: 26.5 nmol
nn008: 29.9 nmol
nn009: 27.5 nmol
nn010: 31.3 nmol
The DNA sequences for each of primers are:
nn001:cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg
nn002:cgcatctcgagtcaggtggcgaacgggccta
nn003:ctagaAGATCTgtgaccatcaccccgcccgc
nn004:cgtcactcgagtcaggccgtttcgcggacgc
nn005:ggttcgagcggctcctTgaggaccagggctccggac
nn006:gtccggagccctggtcctcAaggagccgctcgaacc
nn007:ctagtAGATCTgtgatcgtccgatcgttcag
nn008:gtctactcgagtcaggcctcctcggtcagca
nn009:cggatAGATCTatgaccaccgaagtacgcgc
nn010:gtctactcgagtcaggcctcctcggtcagca
After adding water, I vortex them so that all the loose particles would settle down, and the tubes were put on ice. After placing the tubes in ice, I started predicting my PCR product. My predictions are: ThpA=553 bp; ThpB=1285 bp; ThpC=421 bp; ThpD=916 bp.At the end of the day, I put all 10 tubes in the freezer (below 20).
Nnguyen 14:06, 27 June 2007 (EDT)
Today, I came in and found out that my template has not yet arrived. While I was updating my notebook, I realized that I have the same two primers (nn008 and nn010). nn008 is correct; however, nn010 is incorrect. I just finished putting my correct primer (nn011) on order.
The correct DNA sequence for nn010 is:
nn011:gtcagctcgagctacttcaccggggtgaagt
Without nn011, I am still able to continue with my work even if my template arrives today.
When my template arrived, the DNA was embedded in an organism and so I had to isolate the DNA. I used the Ultra Clean Mircobial DNA isolation Kit to isolate the DNA. After isolating the DNA i was ready for PCR. First, I had to dilute the primer and so I added 1uL of primer to a new tube and I added 9uL of water to each tube. After making PCR tubes and putting the right amount of primers (forward, reverse), template, enzyme, buffer, dNtps and water, I put my PCR tubes in the PCR machine. I used the 3-step program and the process took 1 hour and 14 minutes.
I attempted to PCR again. I had 6 PCR tubes: 3 PCR tubes containing the enzyme expand and Dmso 100% and the other 3 PCR tubes contained the enzyme phusion and no Dmso 100%.
Nnguyen 16:14, 28 June 2007 (EDT)
I checked on my PCR tubes today and found out that the PCR tubes that contain phusion did not work. The PCR tubes that expand worked. This time, ThpA came out right; however, ThpB did not come correctly.
I also cleaned up ThpA and ThpC and digested them. After putting them in the incubator for 2 hours, I took them out and cleaned them up again. After digestion, I underwent ligation by adding vector 9145, my insert (ThpA and ThpC), ligase buffer, ligase and water. After that, I let the tubes sit for 30 minutes to an hour.
Note: Ligation is occuring in two different tubes (ThpA and ThpC)
After ligation was finished, I carried out transformation. I needed 220uL of competent cells and salt solution ( 30uL of KCM and 50uL H2O). After added the salt solution to the competent cells, I added 100uL of the solution to each ligation tube. I mixed it and put them on ice for 10 minutes. After that, I heat shock if for 90 seconds in 42C. I put it back on ice for 2 minutes. I added 110uL to an agar dish, and I used the beads to spread the solution. In the end, I put the agar dishes in the incubator for 16 hours.
The correct reverse primer for ThpD came and I added water to the tube. After vortexing it, I took out 1uL of primer and added to a 9uL of water which makes a total of 10uL. After adding the correct primers, template, enzyme, buffer, dNtps, and water, I placed my PCR tubes into the PCR machine. Unfortunately, PCR did not work for ThpD.
Nnguyen 19:21, 29 June 2007 (EDT)
I came in today hoping that I can get ThpD to work. I tried three different techniques hoping that PCR would work. The first PCR tube, I used the enzyme phusion and HF buffer 5x and everything else is the same as the previous PCR tubes. The second PCR tube, I used the enzyme phusion and GC buffer 5x. The third PCR tube, I used the enzyme expand and expand buffer 10x. After taking the tubes out of the PCR and gelling it, the tube with expand did not have a band; the tube with phusion and GC buffer had too many bands, and the tube with phusion and HF buffer showed a satisfying band.
Since PCR did not work when I tried to sew together the two parts in ThpB, I decided to gel extract the 2 parts. I ran 60uL of ThpBF/ThpBIR and 60uL of ThpBR/ThpBIF on the gel and the bands did not show up at all, even the marker. With the remaining 20uL of ThpBF/ThpBIR and 20uL of ThpBF/ThpBIR, I gelled that and there were faint bands for them. After cutting out the piece of gel, I added 500uL of ADB buffer and heat up the tube so the gel can melt. After it melted, I usedthe DNA Recovery Kit to clean up my gel. After clean-up, I made a solution with Dmso 100% so I can carry out my second PCR.
I finished cloning ThpA and ThpC in the agar dishes. Now I am growing them in LB broth. I have 7 LB broth tubes: 5 from ThpA and 2 from ThpC. I pipeted out 35mL of LB Broth and put 5mL in each tube. I labeled each tube ThpA1, ThpA2.....ThpA5, ThpC1, and ThpC2. Before doing anything to these tubes, I need to make a master solution for my colony PCR.
For Colony PCR I need:
21.8 uL water
2.5 uL buffer
.5 dNTPs
.1 uL Taq
.5 uL Forward primer
.5 uL reverse primer
Total Volume: 25.9 uL
Note: the primers are G0001 and Ca998
I multiply this solution by 8 because I need to divide the solutions into 7 different tubes and by multiplying it by 8 allows me to have extra if I needed it. The total volume after multiplying by 8 is 207.2 uL. After making my master solution, I put 25.9 uL in each PCR (7) tubes (the labels should correspond to the LB Broth tubes). I took a pipet tip and dipped it in a chosen colony, twirl it in the corresponded PCR tube, and then drop the tip into the corresponded LB Broth tube.
Goals for Saturday, June 30,2007
1. gel ThpB (PCR #2)
2. PCR clean-up ThpD and ThpB (if PCR works)
3. Digestion, clean-up ThpD and ThpB (if PCR works)
4. Ligation-->ThpD and ThpB (if PCR works)
5. Transformation
6. Colony PCR-->gel, miniprep
Nnguyen 15:24, 30 June 2007 (EDT)
I came in this morning and retrieved my Colony PCR tubes (7) upstairs and my PCR tubes (ThpB PCR #2). I put 5uL of each in a differnt tubes and put .5 uL of buffer in them, and I put them on gel. ThpB turned out satisfying.
Both of the bands for ThpC1 and ThpC2 were satisfying. Choosing only 3 our of 5 ThpA colony PCR tubes, and both of ThpC colony PCR tubes, I miniprep them. Before I miniprep, I must pour some liquid media in a small blue tube, but I should leave some in the LB Broth tube for later use. After pouring them in the blue tubes, I centrifuge the 5 tubes for 6 minutes to suspend the pellets. After that, I followed the miniprep protocol. After I finished with miniprep, I am supposed to send it to sequencing; however, I will do that on Monday.
Since ThpB is good to go, I PCR clean-up ThpB and ThpD. After cleaning up, they were ready for digestion. After preparing the solution for digestion, I placed the tubes in the incubator for 2 hours. After taking it out from the incubator, I cleaned up again. However, this time when I elute the solution, I only added 10uL of water rather than 80uL. After cleaning up, I went on and prepared a solution for ligation. After adding water, insert, vector, ligase buffer, and ligase, I centrifuge the tubes and let them sit for 30 minutes to an hour.
After ligation was completed, transformation can take place. I need 220uL of competent cells, and I also need a salt solution (30uL of KCM and 50uL of H2O). I added the salt solution to the competent cells and distributed 100uL into each ligation tubes (2). I mixed the tubes and put them on ice for 10 minutes. After taking them off the ice, I heat shock the tubes for 90 seconds in 42C. I put them on ice for 2 minutes and I added the entire solution (110uL) onto the agar dish (there are two: ThpB/9145 and ThpD/9145). I used the beads to spread the solution throughout the plate. After finishing, I put the two agar plates into the incubator for 16 hours.
Note: When I am transferring the solutions into an agar dish, I must be in a sterile area.
My goals for today were all accomplished!!!
Nnguyen 00:15, 2 July 2007 (EDT)
I finished my construction files for all my genes today.
After I minipreped ThpA and ThpC, I sent them off for sequencing. I loaded 4uL of plasmid into a different eppendorf tube and added 4uL of water. I sent off 5 tubes for sequencing. Since ThpA and ThpC are both less than 700bp, I only needed one primer (ca998) rather than two.
I prepared a master solution for colony PCR for ThpB and ThpD. I picked 4 colonies for ThpB and ThpD. Altogether, I have 8 PCR tubes, and I also grew them in LB Broth AMP. I put the LB Broth tubes in the shaker for 16 hours.
Nnguyen 17:19, 3 July 2007 (EDT)
The sequences for ThpA2, ThpA3, ThpA4, ThpC1, and ThpC2 were sent to me. I checked them and Richard said that ThpA2 is contaminated, and ThpA4 either has multiple inserts or none. ThpA3, ThpC1, and ThpC2 worked fine. However, when I checked the sequences to see whether if they matched, ThpA3 did not match very well. ThpA3 had the restriction sites (BglII and XhoI) and about the first 20 base pairs of the gene. It also has about the last 20 base pairs of the gene. Everything in between was junk. In the end, ThpA3 did not work out. ThpC1 and ThpC2 matched up very well; however, in both of the sequences, there was one mutation. They weren't silent mutations. For ThpC1, the mutation took place at 182 bp (only gene ThpC was examined). The desired codon was valine (GTG), but what I got was alanine(GCG). For ThpC2, the mutation took place at 25bp (only gene ThpC was examined). The desired codon was isoleucine(ATC) but I got valine (GTC).
I decided to redo ThpC. I prepared a solution for ThpC and will place it in the PCR machine today before I leave.
As for ThpA, I decided to pick 5 (ThpA1a, ThpA2a....ThpA5a)new colonies to grow in broth, and I colony PCR them today.
Nnguyen 00:08, 5 July 2007 (EDT)
Before leaving on Tuesday, I put a PCR tube into the PCR machine. I redid ThpC, hoping that there would be no mutation this time because it is believed that in the previous one, the mutation occurred the PCR. After PCR clean-up, I sent a sample to Quintara hoping that the sequence matches up with what I predicted. Before sending it to Quintara, I had to dilute my primers twice and then add 8uL of the primer into a different tube, and 5uL of the PCR product. I sent Quintara two samples, one for each primer. Besides sending a sample from ThpCb to Quintara, I also sent another sample from ThpA. The samples I sent from ThpA was from the PCR product I did a while back.
Richard sent me the sequences for ThpB and ThpD. Looking through 3 samples of ThpB, one matched up very well; however, there were a couple of mutations. Looking through 3 samples of ThpD, one matched up perfectly, so that one was good. Since I only used the enzyme phusion for ThpD, I decided to make new PCR tubes that consist of phusion for ThpA, ThpC and ThpB.
After cleaning up ThpCb (the one that I sent to Quintara today), ThpCb went through digestion, clean-up, ligation and then transformation.
I chose 10 more colonies from my plate from ThpB/9145. I was unable to grow them in culture tubes because the tubes weren't available during the time. This time, I twirled the colony in the PCR tube and then marked an "X" on a different plate.
Nnguyen 18:28, 6 July 2007 (EDT)
I came in today and I retrieved my PCR colony tubes (10 from ThpB) and my PCR tubes (ThpBc, ThpBIc). After gelling them, out of the 10 PCR colony tubes 2 had satisfying bands. ThpBc and ThpBIc had satisfying bands. After seeing that the bands were good, I gelled the entire volume of ThpBc and ThpBIc. After gelling them , I gel extracted them and cleaned them up. After cleaning, ThpBc was ready for its second PCR (sewing). Instead of using expand, I used phusion with the addition of Dmso 100%. There are two tubes for PCR #2 because while I was gel extracting, there were two bands for ThpBc, and I extracted both of them because they were within the range that I wanted. After PCR was done, I gelled and there weren't any bands. I tried sewing once more;however, this time I used expand, and it still didn't work.
For ThpCb and ThpA, I picked 8 colonies from each plate and grew them in culture tubes and colony PCR them. After Colony PCR, I ran them on gel and there were bands and ThpCb seemed to have the desired band. After choosing 3 samples for ThpCb (ThpCb3,ThpCb6,ThpCb8) and ThpA(ThpA3b, ThpA6b, ThpA8b), I miniprepped along with 2 samples from ThpB.
Nnguyen 01:40, 9 July 2007 (EDT)
I sent ThpCb3, ThpCb6, ThpCb8; ThpA3b, ThpA6b, ThpA8b, ThpB4a, ThpB5a to sequencing. For ThpB, I needed to add the ca998 and G01001 because it has 1200 base pairs.
For ThpBc, I tried sewing the two parts together. However, this time I only have one tube because I did not have enough of the part with the internal site.
Nnguyen 15:35, 10 July 2007 (EDT)
Today, Richard sent me the sequences for the samples that I sent yesterday. Fortunatley, 2 of the ThpCb (ThpCb3 and ThpCb6) samples worked. For the other samples, there were a couple of mutations.
I sent in 10 more sample for ThpA because the sequences from the PCR product for ThpA was fine.
I transformed the right RBS I got from Vinni into a lefty. I also transform ThpCb6 and ThpD2 into righty cells.
Clone Savor: I took 10uL the broth media that I had of ThpCb6 and ThpD2 pipetted unto a piece of paper (clone saver.
Nnguyen 18:43, 11 July 2007 (EDT)
The sequences for ThpA came in and one out of 10 matched very well; unfortunately, there was one mutatioin.
The PCR product for ThpB has two mutations. The mutations might be within the genome itself or it might be a result from PCR.
I decided to send ThpB back to sequencing. This time, before sending it to sequencing, I'm going to put it in the PCR machine. I used the BglII and XhoI primers instead of using the primers that will remove the internal sites.
Transformation worked great for ThpCb6, ThpD2, and RBS. I picked out a colony and grew that in liquid media.
Lefty: RBS
Righty: ThpCb6, ThpD2
I picked out 8 more colonies from plate ThpA/9145 and colony PCR them. Hopefully after miniprepping them and sending them to sequencing, the sequences will turn on out great.
Nnguyen 12:38, 12 July 2007 (EDT)
I came in and took out the liquid media for ThpCb6, ThpD2, and RBS from the incubator. I minipreppred those and got them ready for digestion. For RBS, I had:
20uL of water
6 uL of plasmid
3uL 10x buffer NEBuffer #2
.5uL of BamHI
.5uL of XhoI.
For ThpCb6 and ThpD, everything is the same as RBS except for the enzymees that I used. I used BglII and XhoI for ThpCb6 and ThpD2. The total volume for my digestion tubes was 30uL. The tubes were put in the incubator for 2 hours. After digestion, I prepared the tubes for ligation. The duration for ligation was 30 minutes to an hour. In the ligtaion tubes, I had:
4uL water
3uL insert (smaller piece-->ThpCb6,ThpD2)
1uL vesctor (larger piece-->RBS)
1uL ligase buffer
1uL ligase
The total volume for ligation wa 10uL.
After ligation was finished, I had to heat kill the ligase for 15-20 minutes. After heat kill, I digested the ligation product with BamHI and BglII. The volume for the digested ligation tubes was 20uL. In the tubes I had:
10uL ligation product
7uL water
2uL buffer #2
.5uL BamHI
.5uL BglII
After digestion, I got ready for transfomation. Instead of using competent cells, I used the lefty and righty cells. I had to grow RBS-ThpCb6 into a lefty strain, and I grew RBS-ThpD2 into a righty strain. I put the dishes into the incubator for 16 hours.
ThpA has been having some problems with sequencing because the sequences haven't been matching up very well. In order to fix this problem, I carried out the process of ligation again for ThpA.
Nnguyen 13:00, 16 July 2007 (EDT)
I came in today and retrieved my plates and found out that there were good colonies on RBS-ThpCb6, RBS-ThpD2, and ThpA.
The sequences for ThpB came in today, and it seems that the two constant mutations are in the template itself. So now, ThpB is ready to go. Two days ago, I transformed ThpB5a into a righty strain. I grew one colony in liquid media. Today, I miniprepped it and carried out with digestion for 2 hours.
