McGill/July
From 2007.igem.org
| July 2007 | ||||||
| Su | M | Tu | W | Th | F | Sa |
| 1 | 2 | 3 | 4 | 5 | 6 | 17 |
| 8 | 9 | 10 | 11 | 12 | 13 | 14 |
| 15 | 16 | 17 | 18 | 19 | 20 | 21 |
| 22 | 23 | 24 | 25 | 26 | 27 | 28 |
| 29 | 30 | 31 | ||||
</td></tr>
Contents |
July 2007
July 1
- Diluted seedings of I+J (in supp. M.M.), J40001, I15004 (in Top10 cells with LB), I5610.
- To the dilutions, after an O.D. of 0.2-0.3 was reached, IPTG/DOX/AHL were all added to each biobrick dilution, and another dilution was left as a control.
Results: I5610 (repressilator) did not show any fluorescence in the confocal microscope.
J40001 showed some fluorescence.
The samples of I+J, J & I in AHL/DOX/IPTG were then left longer in incubation and then viewed on the confocal again.
Results: I5610 again showed no fluorescence, J40001 very little, and the I+J was continually drifting, we concluded that this was probably due to an illumination problem of the microscope equipment itself and not the DNA.
- Seeded I+J in supp. M.M. again for the plate reader experiment tomorrow.
July 3
- A superconcentrated midiprep of the I5610 cells was done as following the elution of the plasmid, the DNA was all pooled into 1mL of ethanol this making it doubly concentrated.
- A large-scale digest of I15004 was conducted using the following formula
10uL buffer
0.5uL BSA
20uL DNA
17.5uL water
1uL SpeI
1uLXbaI
Following the digest, a gel extraction was conducted to isolate the I insert and the DNA was stored in the freezer. Unfortunately, the cuts may have severed the resistance of the insert thus it cannot be used in further ligation steps. Alternatively, a PCR of the plasmid will be done to isolate the insert to be ligated into another plasmid with a high copy number.
- A further transformation og I5610 into MC4100 cells was repeated with a 2 minute HS and plated on AMP/Kan plates as the previous attempt at imaging showed no florescence indicating a bad tranformation or DNA sample.
- I+J were viewed on the plate reader at different concentrations (in 350ul M.M. and in 1ml M.M.) after reaching an O.D. between 0.2-0.3 and a series of consecutive washings in MM. A kinetic reading was then taken over 2 hours, with 5 minute intervals, with a high sensitivity and at 32C. The excitation wavelength as set to 430nm and the emission wavelength was set to 475nm. A transparent cover was placed atop the plate reader to prevent drying out over the testing period.<p>
Results: The were possibly oscillations at both high and low concentrations, with a greater change in the diluted I+J. The results seemed to show only the end point of the oscillation, where the graph levels off.
- A third plate reading experiment was done with a newer batch of O.D.'d I+J cells, to see a pull cycle of oscillations. The results seemed promising, however, after showing it to Jay, she concluded that the fluorescence intensities were too random to be substantial.
July 4
- A large scale digest was done again, this time using different restriction enzymes (XbaI & BanII), with cuts at 1.8Kb and 3.8Kb on a 5.6 Kb plasmid. The digest was then run on a gel with large wells for 1h20mins. When viewed on the computer, the cuts were precise and the bands were clear.
We then proceeded with gel extraction in the evening after cutting out the I15004 insert. However the I15004 extraction was useless as we later found out that the restriction enzymes used also cut some of the Kan antibiotic resistance from the plasmid, thus making the insert unusable. - Seeded I+J in supplemented Minimal Media.
- As there were no more miniprepped J brick in the freezer, we had to seed a few more colonies from a June 1st transformation of the brick, in LB.
July 5
- I5610 seeding from yesterday were diluted 20X in supplemented MM and grown to an OD of 0.2-0.3 for imaging. Upon investigation under the microscope, no florescence was present under the new YFP filter thus again, the represillator appears to be inactive.
- J-brick from the old June 1st plates were again seeded in LB and grown overnght in the IS.
July 6
- Imaging on the MNI confocal was not successful because the sample kept drifting out of focus (or is it the microscope that can't keep focus?).
- Imaging on the 5th floor confocal also showed that the focus was changing under bright field. The sample was not showing any fluorescence, though (bad colony?).
- On Monday, we need to determine if it is the microscope or the sample that is causing the problem. We need some fixed bacterial slides to look at.
- Ordered Streptomycin, primers for the isolation of the I-insert and CcdB resistant cells from invitrogen.
Cloning Strategy for I15004 in pSB1AK3
A. Vector Preparation
1. Transform psb1AK3 in OneShot CcdB resistant cells
2. Plate on Streptomycin plates
3. Miniprep
4. Digest with EcoRI and PstI
B. Insert Preparation
1. PCR I15004 gene with standar biobrick primers
Primers: Forward: 5’ attaccgcctttgagtgagc 3’ | Reverse: 5’ tgccacctgacgtctaagaa 3’
2. PCR Purification
3. Digest with EcoRI and PstI
C. Ligation
1. Prepare an insert:vector ratio of ~1:3
2. Perform Ligation
D. Transformation
1. Into MC4100 cells (with J brick too)
July 8
Seeded 3 colonies of J40001 again from the same plate (June 1st, 100ul volume) in 1X LB and Amp.
July 9
- Transformation of J-brick from the biobrick plates into Top 10 cells. HS of 2 min with 3uL of DNA was conducted.
- Transformation of the I5610 from the biobrick DNA was also conducted into MC4100 cells in a final attempt to see florescence.
July 10
- Seeding of J40001 and I5610 was done.
July 11
- Miniprep of J40001 for use to make more I+J oscillating systems.
- Restriction Digest of the J brick was conducted with EcoRI and PstI and its presence was confirmed
- A PCR was also conducted (as per Elvis' protocol) in attempt to amplify the I15004 insert from the standard primers ordered from MIT. The protocol appears in the protocol section.
- ccdB cells arrived for the tranformation of the new pSB1AK3 plasmid and these were diluted to 100mL in preparation for the chemically competent cells proceedure tomorrow.
July 12
- Chemically competent cells were made (following Annette's protocol) of the ccdB cells.
- Transformation of the pSB1AK3 plasmid into these cells was then preformed and plated on AMP/KAN plates. After grown overnight, there was only a single colony indicating that the home-made cells were indeed incompetent or the transformation was bad. A new protocol specific for the transformation of ccdB cells was found and utilized the next day.
- A PCR purification was also preformed as found on openwetware (see protocol section again) and following a large-scale gel, no bands were present meaning that the insert was not amplified or simply lost during the purification step.
July 13
- pUC19 was transformed into the homemade cc ccdb cells to test the efficiency using the modified transformation protocol. Upon overnight growth, less then 5 colonies on two plates (each with 100uL of diluted solution) was presented so the competency of the cells has somewhere been compromised; thus, the commercial cells will be used from now on.
- A I+J transformation was also conducted and plated on amp/kan plates.
- The PCR was also repeated using Elvis' protocol though the apparently proper annealing temperature of 51 degrees was used.
July 15
- made AMP
- Amplyfied cc cells
- PCR I-brick
PCR steps (IGEM) 1.heat to 95 5 mins 2.cool to 57 then 1 min pause 3.heat to 72 then 1 min pause 4. cycle again
- I+J was transformed into MC cells
- pUC was transformed into ccDB cells used 2 different heat shocks time
July 17
- made LB and dH2O
- AMP-KAN plates were made. agarose was taken form 7th floor lab
- Ran a gel
- I+J was also seeded in Supp.M.M for imaging
- pSB1AK3 was seeded in 1x LB
- I15004 was miniprepped for a large scale digest
An unexpected band was found at 1.2 kb
July 19
pSB1AK3 was miniprepped I+J was imaged
July 23
- Miniprepped I-brick
- Then it was digested with
a) Afe I, Pst
b) Ban II, Xba I\
- pSB1AC3 was transformed into ccdB cells
- I+J was seeded
- AMP-CAN and AMP-CAN-KAN plates were made
AMP: 1ul/ml
CAN: 0.8ul/ml
KAN: 5ul/ml
July 24
Performed the following dilutions for the Plate Reader:
- I+J: 10X dilutions x2
- I+J (+AHL): 10X dilutions x2
- I+J (+DOX): 10X dilutions x2
Performed the following dilutions for the microscope (7th Floor):
- I+J: 10X dilutions x2
- After reaching a high O.D., for the microscope, pictures were taken every 15 mins. for 2 hours, taking both bright field and fluorescence images (Mono).
-However, after 2 hours of imaging, there appeared to be no increase in cell number, although there was fluorescence. Cells also appeared to photobleach. We were left to conclude that the cells were either dead or suck, maybe due to preparation or quality of transformed plates.
- For the plate reader experiment, we concluded that the graph of fluorescence for all three types of preparations appeared too random over 7 hours to prove substantial.
July 25
- Performed a large scale digest of I5610 using XbaI & PstI. With expected cuts at 2.1kb and 4.3kb.
- Transformed psB1AC3 (21B well) on plates.
- Transformed I, J, I+J in different concentrations of Kan antibiotic when required (5ul/ml, 7.5ul/ml, 10ul/ml). This was done to find out which was the best concentration of Kan to use for further experiments, as well as eliminating the possibility of contaminated colonies still growing on our plates.
-After running a gel (Large wells) of I5610, results were anomalous. Expected bands did not appear where they should. -However, for the screening digest of pSB1AK3, a band was found at ~3.7kb instead of 3.2kb. However, this band was sufficient as a Log scale ladder shows unequal scale changes, so we interpreted the plasmid to be present.
July 26
Results from last night's transformation:
- Heavy colony growth, with I15004 growing well in all 3 concentrations of Kan. The greatest growth was observed on the 5ul/ml Kan plates (as expected). With 7.5ul/ml and 10ul/ml showing medium to large colony growth.
From these results, we decided on using Kan concentrations for plates at 7.5ul/ml from now on.
- Very few colonies grew at all in the I+J plates (transformed in MC4100) at all 3 concentrations of Kan (5ul, 7.5ul, 10ul/ml).
- Susan came in to seed the few I+J colonies for microscopy as well as some I, and J colonies in LB.
- Re transformed I+J in MC4100 cells again, this time at 7.5ul/ml Kan concentration.
July 27
- No colonies grew for the I+J plates again.
- Diluted and ashed I+J, I, J in AHL, DOX and no additions. Again, no substantial results were found.
- Mini prepped I, J & pSB1AC3.
July 28
- Test: Growth of J40001 in Kan to test the sensitivity to the opposite resistence. Results were obtained on the basis of the resulting OD when the J was grown in different concentrations of Kan
- 5uL/mL OD: 0.917
- 7.5uL/mL OD: 0.920
- 10uL/mL OD: 0.838
- 15uL/mL OD: 0.837
- 20uL/mL OD: 0.782
- Based on these results, the higher the concentration of Kan, the lower the growth of J thus the highest concentration of KAN that is sensitive to the I brick should be used.
Imaging: First samples seeded from yesterday were diluted in the morning each 10X and to 5mL of Minimal Media. The seedings were washed and pellets from two seedings were pooled into one sample and made up to two different concentrations (0.5mL and 1.5mL of final added supplemental minimal media). Further, dilute and concentrated samples were also made through growth in either DOX or AHL to test the reactivity of the system. The samples were placed in the plate reader for 18 hours and the data analyzed the next day.
Note on AHL and DOX: AHL stock contains 10 000X concentration which must be diluted by 10X and then added to the solution as 1uL/mL. DOX stock allready exists as 1000X and thus can be added as 1uL/mL.
Results suggest the DOX and AHL indeed have an effect on the flourescence. Oscillations inconclusive as any potential osciallations could be attributed to random noise. The dilute samples gave the expected results where the absolute value of the DOX was lower then the control (I+J) and the AHL was higher. Interestingly though, the concentrated sample had opposite results. The concentrated DOX showed increased flourescence whereas the concentrated AHL showed decreased flourescence possibly from the sensitivity of the system to AI levels.
July 30
After a meeting with the theory people, a new approach is to be taken with the project. A new I brick has been ordered that should have the proper sequence as well as an addition with a consitutive promoter with the LuxR to eliminate the cross-talk of the pTet promoter of the current LuxR and the repressilator system. This new insert shall be ligated into a medium-copy number plasmid pSB1AK3.
Also, a series of news transformation are to be carried out to try to repeat the oscillations from last year. The I5610 repressilator and the I+J system are both to be put into BL21 cells (which contain an endogenous Lac) as was done in the previous year. As a control, these two systems shall be transformed into the MC4100 cells as has been many times before. Also, the other repressilators, I5611 and I5612, are to be amplified in Top10 to test the bands for them and to see if the correct DNA is indeed present (as the I5610 is deemed to not be correct). Lastly, E0434 and J0445 are to be amplified in Top10 as well as these contain YFP and RFP respectively and can be placed on the I5611 repressilator as an assay as this repressilator does not have it. As for the transformations, all were done with 5uL of DNA and with the following heat shock times: 2 minutes for Top10, 45s for MC4100 and 2 minutes for BL21.
The results proved to be decent with the following colony growth:
- 15611 in top10 dozen good colonies
- I5612 in top10 2 decent colonies
- I5610 in BL21 dozen good colonies
- 15610 in MC4100 6 good colonies
- I+J in BL21 2 large strange colonies
- I+J in MC4100 no colonies
- E0434 in top10 about 50 great colonies
- J0445 in top 10 about 25 great colonies
July 31
- First, a large-scale restriction digest is to be implemented on the pSB1AK3 with both EcoRI with PstI and XbaI with SpeI (simply as digests have not been terribly successful this year. The plasmid was digested as to prepare it for the arriving I brick from the the sequencing company. The digest was run for 2hours 45 minutes and run on a gel for 80 minutes.
- A series of seeding were also preformed to test the sensitivity of the I and J bricks to the antibiotics.
- I in Kan (5, 7.5, 10, 20, 50uL/mL)
- J in Kan (5, 7.5, 10, 20, 50uL/mL)
- I in Amp (1, 2, 5, 10, 20 uL/mL)
- J in Amp (1, 2, 5, 10, 20 uL/mL)
- Seedings of the successful transformations were also done in minimal media or LB depending on whether amplification or imaging was to be done (all I+J and I5610 were in minimal media and the rest in LB)
Augest 1
- Dilutions of all the seeding yesterday intended for imaging todya on the plate reaser where done. For the oscillator (I+J), only BL21 cells grew thus the experiment shall be carried out thusly and compared to previous results in the MC4100 cells. 350uL of culture was diluted to 5mL of minimal media making a total of 16 dilutions. Of these, to 4 of them, AHL (1uL/mL) was added and to a further 4, DOX was added (1uL/ml). At an OD of 3, each set of two dilutions were washed into one epitube and made into both a concentrated (0.5mL final volume) and a dilute (1.5uL final volume) and run on the plate reader for 18 hours.
- Results from the antibiotic experiment were nonsense thus a repeat must be made. The following ODs of the sample are listed below:
Control, no antibiotics: 1.643
- Control Kan (no colony)
- 5 uL/mL 0.744
- 10uL/mL 1.080
- 20uL/mL 1.109
- 50uL/mL 1.126
- 100uL/mL 0.841
- I in Top10 in Kan
- 5uL/mL 1.133
- 10uL/mL 1.188
- 50uL/mL 1.143
- 100uL/mL 0.744
- J in Top10 in Kan
- 5uL/mL 1.080
- 10uL/mL 1.109
- 20uL/mL 1.126
- 50uL/mL 0.841
- Control Amp (no colony)
- 1uL/mL 1.133
- 2uL/mL 1.188
- 5uL/mL 1.143
- 10uL/mL 1.121
- I in Top10 in Amp
- 1uL/mL 1.072
- 2uL/mL 1.254
- 5uL/mL 1.028
- 10uL/mL 1.092
- J in top10 in Amp
- 1uL/mL 0.194
- 2uL/mL 0.080
- 5uL/mL 1.030
- 10uL/mL 0.199
