McGill/Team 2: Repressilator
From 2007.igem.org
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Contents |
May 2007
May 11
Autoclaved LB, Agar and Minimal Medium. Made plates with AmpR, KanR and both Amp and Kan. Concentrations used (same for cell cultures):
- Amp: 1uL/mL
- Kan: 10uL/mL
- Cam: 0.8uL/mL (from Elvis' aliquots)
The receipe for M9 Minimal Medium is in my lab notebook which is in the lab so I'll post it later under the Protocols section. Hopefully we can get the 2007 wiki soon. Horia
May 14
Moved plates from iGEM fridge to fridge on C block (end of hall) Made 100X Yeast extract and 10X Dextrose (for supplementing minimal medium) Prepared CaCl2 and CaCl2/Glycerol 10% solutions for CC procedure of tomorrow Will seed tonight. Horia
May 15
Performed cc procedure with top10 (elvis' home made), bl21 a1 and stble3
Performed seeding procedure on plates from last year: ILS004, duplicate copies of 5mL LB with 50uL KAN; RSE/J40001, duplicate copies of 5mL LB with 5uL AMP; Place in IS overnight
May 16
Transformed cc cells with pUC19 and plated
Repeated seeding procedure as that from previous day did not prove any results (defective shaker?). Both ILS004 and RSE repeated in triplicate with its respective antibiotic. Placed in IS at noon and two samples diluted with LB (100mL to RSE sample and 80mL to ILS004) and placed in the IS overnight. No cell growth.
May 17
Nothing grew on most of the plates. Only 2 colonies on a stble3 plate. Decided the cells were bad because 1. we did not keep them on ice while we transported them etc. and 2. some cells waited a long time on ice because we had to do sequential centrifugations (not enough of one kind of tube). Removed from incubator at night and placed in the fridge.
Susan, Avi and Jimmy seeded cells again for Friday. BL21, Top10 and STBLE3 repeated in triplicate in 5mL LB and placed in SI overnight.
May 18
Performed cc procedure.
May 22
Made LB for Seeding procedure from 15.5g of solid LB to 500ml of water - x3.
Performed transformation of competent cells with PGFP (which was supposed to be pUC19) (Top 10 and Stble 3) and BL21 with PGFP and Amp antibiotic to validate their quality.
For the transformation procedure, used LB instead of S.O.C. Medium, due to its unavailability, then spread the cells on Agar gel plates with Amp and LB and placed in incubator overnight.
Made some additional Agar gel plates with Amp, which were kept in the freezer for future use.
May 23
Test transformation results
BL21
30s / 2 min Heat Shock
20 µl = 0 cells / many cells
75 µl = 0 cells / many cells
Top 10
30s / 2 min Heat Shock
20 µl = many cells / many cells
75 µl = many cells / many cells
Stable 3
30s / 2 min Heat Shock
20 µl = ~ 30 cells / 7 cells
75 µl = ~ 30 cells / 3 cells
Then performed transformation using Top 10 cells. Added biobrick (10M well) with Kan plates (200µl & 50µl) and RSE with Amp plates (100µl & 20µl). Left in incubator overnight at 37C.
Also, six seeding were preformed on test colonies transfected with PGFP and let in the IS overnight.
May 24
Miniprep protocol (from iGEM 2006) of Top10 and STBLE3 cells transformed with pGFP plasmids and seeded yesterday. BL21 cells were tested for the presence of the pGFP plasmid through microscope examination which proved positive results.
A restriction digest was implemented on the isolated DNA from the Top10 and STBLE3 cells
1.5uL Buffer 2
0.5uL of BSA
3uL DNA
8uL water
1uL EcoRI
1uL XbaI
Due to lack of ethidium bromide, a gel could not be made so the run was postponed for Friday.
May 25
First, the Top10 and STBLE3 were again digested as per the digestion above to be run in parallel with the digestion from yesterday.
An electrophoresis gel was made
50mL of TAE
0.35g agarose
heated ~20s then cooled to <60 degrees Celsius
7uL of ethidium bromide was added and poured into a gel plate
1.74uL of 10X loading dye was added to the DNA and the gel was run for 45 minutes at 100V; upon completion, a picture was taken to reveal no bands.
A miniprep was also preformed on the iBrick (Il5004 plasmid) and RSE cells (J40001 plasmid) seeded the day before and DNA stored in the freezer.
May 28
Today, a restriction digest was preformed on the iBrick and RSE cells with the following respective solutions in duplicate
IL5004
1.5uL Buffer 3
0.5uL BSA
3uL DNA
1uL PvuII
1uL PstI
8uL water
Jh0001
1.5uL Buffer 3
0.5uL BSA
3uL DNA
1uL EcoRV
1uL PstI
8uL water
Again, a gel was run and again, a negative result was obtained showing no bands.
May 30
Midi prep of iBrick with a new midi prep kit.
Seeding of J-brick (RSE) and Jay's pEGFP and pTet
May 31
A gel was run with the following wells.
- I-brick from yesterday's midi prep
- I-brick from yesterday's midid prep (2)
- RSEI
- RSE2
- pEGFP mini prepped
- pTet mini prepped
- Elvis's pGFP
The gel from yesterday's midi prep was successful and DNA was present.
Dilutions where implemented on the seedings from yesterday
June 2007
June 4
- Performed a restriction digest of midi preps: pEGFP, pTet, J brick. pEGFP (EcoRI & XbaI); PTet (Xba1); J brick (EcoRV & Pst)
- After digest, made a gel using L2 Ladder. To prepare L2 use 3:1:1 (H20:Dye:TAE).
Wells: 1. pEGFP 2. pTet 3. J Brick - Seeded the following plates: I+J (20ul&100ul); I1500S (1x with LB & 1x with M.M.); J4000I (1x with LB & 1x with M.M.)
Gel showed abnormal bands with smudges. This could be due to improper well loading or gel transfer.
June 5
After seeding, results showed that the J brick grew abnormally, growing better with M.M. than with LB. I+J (double seedings) did not grow at all in both mediums. The I brick grew in LB but not with M.M.
Conclusion: Possibly bad colonies were selected or there were problems with the transformation procedure.
- Transformed plates again along with Supplemental plates.
- Seeded I, J and I+J (2007 & 2006 plates) again, 3 colonies selected each as well as 2 Control tubes (1x LB; 1x LB+Kan/AMP)
June 6
- Made 23 Kan+Amp plates.
- Transformed commercial biobricks (I15004, J40001, Elowitz (I5610)) in pSB1A2 plasmid (AmpR) with Stble 3 cells. Left overnight in incubation room.
June 7
Results from last night's transformation:
I15004
20ul: 3 big colonies, many small colonies
100ul: 20 big colonies, many small colonies
J40001
20ul: 2 big colonies, few small colonies
100ul: 7 big colonies, no small colonies
I5610
20ul: 1-2 small colonies, little growth
100ul: 1-2 small colonies, little growth
Seeded plates with LB. 1 colony from each plate chosen (2x each biobrick). 6 seedings in total. Left in S/I overnight.
June 8
Of last night's seedings, only two tubes showed visible growth: I15004(100ul)& J40001(100ul). No growth seen in I15610(Elowitz) in both concentrations.
Performed a Miniprep of I15004 & J40001. Kept in freezer.
June 11
- Restriction Digest and Screening: I15004 and J40001 plasmids miniprepped on Friday were digested as per the following
I15004
1.5 uL Buffer 3
0.5uL BSA
4uL DNA
7uL water
1uL PVUII
1uL PstI
J40001
1.5 uL Buffer 3
0.5uL BSA
4uL DNA
7uL water
1uL EcoRV
1uL PstI
Digestion was run on gel though there were no bands as the TAE was improperly made. Seeding were repeated to be prepared tomorrow (2X I15004 20uL, 2X I15004 100ul, 2X J40001 100uL).
- I5610 was transformed into commercial STBLE 3 cells with a HS of 45s and plated onto AMP resistant plates.
- Seedings were preformed in duplicate for the Il5004 (20uL and 100uL plates) and the J40001 (100uL plates) and placed in the IS overnight.
June 12
- Repeated the digest from June 11 and run on a properly made gel. Results indicated that the J brick was indeed present though the I brick was inconclusive due to erroneous cutting. Diluted uncut plasmids (1ul of DNA to 5uL of water) were also run and the I-brick indicated that the insert my not be present so further analysis is required. Also note that the bio-brick was diluted with 3uL of water to dissolve the dry DNA.
- Made KAN (10uL per mL) and Amp/Kan plates
- Seeding of the I5610 in commercial STBLE 3 cells and placed in the IS overnight. Results were poor as the wrong STBLE 3 cells were used and not enough DNA was implemented due to the dilution preformed earlier.
- Seedings of the Il5004 and Jh0001 were diluted to 100mL (100uL of DNA) for midiprep tomorrow.
- Elowitz MC4100 cells were plated on antibiotic-free plates.
June 13
- Il5004 and J40001 midiprep
- Re-transformation of the I5610 into the correct commercial STBLE3 cells using 2uL of DNA instead of 1.5uL as it the DNA was previously diluted. The transformed cells were plated on AMP resistent plates with volumes of 10, 50 and 100uL.
- The new Elowitz cells (MC4100) for the repressilator were seeded for the chemically competent cell procedure to be conducted tomorrow.
- New KAN antibiotics were made and sterilized as per the procedure recorded in the protocal section. New information: since Il5004 is a medium copy number plasmid, we should be using 5uL per ml opposed to 10uL per ml for plating and seeding with this DNA thus from now on, these concentrations are implemented.
June 14
- I5610 were re-transformed into commercial STABLE3 cells as there was limited growth on the previous plates from before.
- I5610 seeding were diluted to 100mL for the cc procedure.
- Restriction digest of I and J plasmids from yesterday's midis as per the cuts on June 11. Again, the I brick yielded inconclusive cuts and smaller than expected total plasmids indicating that the insert may not be present; thus, a PCR will be preformed to confirm the presence of the insert and to amplify the DNA.
June 15
Research using primer 3 program to find unique and adequate primers to be ordered in due time.
June 18
- More Kan plates and AMP/KAN plates were made using the lower concentration (5uL per mL) of KAN.
- The MC4100 cc cells were transformed with 3uL of pGFP using both a 30s and 2min HS and then plated on AMP plates. IL5004 (1.5uL) were also tranformed into STBLE3 using a 2min HS and plated on the new KAN plates. Results: The MC4100 cells only yielded adequate colonies for the 2min heat shock and even with this, a large volume (75-100uL on a plate) yielded a dozen colonies. For the Il5004, there again was only a few colonies (less than before) an with a large volume of plating mixture (125uL) thus indicating that a larger amount of DNA should be used especially considering that the bio-brick has been diluted.
- Il5610 were seeded and placed in the IS overnight.
June 19
Last night's transformed plates of pGFP+MC4100 showed that the best heat shock time for MC4100 cells is 2 min. compared to 30s. as nothing grew at 30s. but good colony growth at 2 min.
- Double transformation of the Il5004 and J40001 into commercial STBLE 3 cells using 2.5uL each of DNA for the I and J bricks with a 2 minute heat shock. Plated on new AMP/KAN resistant plates.
- The seedings from yesterday were miniprepped and stored in the freezer.
- Seeding of the pGFP in MC4100 for microscope verification tomorrow using supplemented Minimal Medium (as LB auto fluoresces) and of the Il5004 in commercial STABLE3 using LB.
June 20
Last night's double transformation of I15004 & J40001 were done using the wrong cells, with MC4100 the appropriate ones compared to STBLE3. This is as STBLE3 are not expression cells and BL21 cells are also inappropriate as they do not properly express Lac- properly.
- Diluted pGFP seedings 20-fold upto 40ml. with supplemented Minimal Medium. These seedings were then viewed on the confocal microscope, showing excellent visual green fluorescence.
- Diluted I15004 seedings to 100ml for Midiprep tomorrow.
- A double transformation was performed again of I+J from left over midiprep DNA with MC4100 cells this time. Heat shock time used=2 min.
- A restriction digest was performed on previously miniprepped I5610 using a double digest from EcoRV and HindIII restriction enzymes. However, after running a gel, a clear insertion was not seen in the cut plasmids. Will need to repeat procedure.
June 21
Unfortunately, the transformation from yesterday was accidently plated on AMP plates rather than AMP/KAN plates so the transformation was wasted. Colonies present on these plates indicate, however, that the J40001 was sucessfully transformed into the MC4100 cells.
- A midi prep of the diluted I15004 from the STBLE3 was preformed and stored in the freezer for a digest tomorrow.
- A double Transformation was repeated again for the I15004 and J40001 bricks from the miniprep DNA (16-06-07) using 2.5uL each of the DNA and a heat shock of 2 minutes into MC4100 cells. The transformed product was then properly plated on AMP/KAN plates and left in the incubator overnight.
- The miniprepped I5610 was repeated using multiple cuts and with uncut plasmids and further run on a gel. the gel revealed strange cuts with the uncut DNA showing two bands, one characteristic of the plasmid and the other of the insert and the cuts themselves were unpredicted but one.
June 22
Unfortunately, there was no growth on the transformed plates again most likely due to inadequate amount of DNA (namely the I15004) or possibly poor plates.
- Restriction Digest of the I15004 from yesterday's midi prep was preformed using three different cuts and run beside the uncut plasmid.
- The restriction digest of the I5610 was also repeated using the same cuts and uncut plasmids and an additional single cut to linearize the plasmid to reduce supercoiling.
- Again, a double transformation was preformed of the I15004 and J40001 into the MC4100 cells. 3.0uL of miniprepped (16-06-07) J40001 and 4.0uL of midiprepped (21-06-07) I15004 were transformed, HS for 2 minutes and plated on AMP/KAN plates.
- Gels worked. On I15004 showed that the insert was present and that cuts were made by restriction enzymes.
- On the Repressilator gel, different uncut bands showed different migrations on the gel. We concluded that this was due to supercoiling. Expected cuts were present on some of the restriction enzyme combinations.
June 26
- A single I+J double transformed colony grew on the Amp/Kan plates. Due to the scarcity of colonies, half of the colony was spread on a new Amp/Kan plate and left in 37C incubation overnight, to promote further colony growth.
- The other half was seeded in supplemented Minimal Medium and left in the S/I overnight. This will be diluted and viewed on the microscope for fluorescence tomorrow.
June 27
- I+J seedings were diluted into 4 culture tubes (250ul each) in supplemented Minimal Medium.
- Spreading of I+J colony on Amp/Kan plate was done incorrectly, as there were no single isolated colonies. Two new Amp/Kan plates were spread, one from the original I+J transformation plate and the other from a colony on the incorrectly spread plate.
- J40001 was transformed on MC4100 cells to produce a negative control.<p>
- The I+J dilutions, once reaching an O.D. of 0.25-0.30, were viewed at different cell densities (concentrations of Minimal Medium). IPTG (Lac- analog) was first added, left in incubation for 1hr, then washed several times with centrifugation in Minimal Medium. This produced 2 epitubes of I+J (One 4X concentrated, the other, 4x less concentrated).
The cells were then viewed on slides (fixed in 2% low grade Agarose - 0.2g agarose to 10mL of minimal media) on the microscope and pictures were taken every 5 minutes for 1 hour.
Results: Images were continuously moving out of focus on the microscope, so oscillations were difficult to identify. After adjusting the focus before each image, due to the subjective nature of the manual focusing, images were still not sufficient to tell oscillations, although there were plenty of fluorescence.
The cells were then viewed on the confocal microscope. Images were taken, but again the microscope continually went out of focus. The microscope was left on for 4 hours, but due to the off-focusing, images were not sufficient to prove oscillations occurred.
June 28
- Transformation of J40001 with MC4100 cells was successful on Amp plates.
- Spreading of I+J colonies on new Amp/Kan plates were also successful, with plenty of available colonies to seed from.
- Adam showed the procedure to correctly perform a PCR.
- J40001 (negative control) was seeded in supplemental Minimal Medium.
- I5610 (3ul) from Midiprep DNA was transformed (as a control) with MC4100 onto Amp plates.
- I+J colonies from the newly spread plates were seeded again in supplemented minimal medium. 3 colonies were chosen an were left in the S/I overnight.
- The I+J diluted cells were again placed under the microscope, this time using a lesser volume of cells & 4% low grade Agarose fixative, to hold the cells in place more strongly and to allow images to be taken from a single strong fluorescence focal point.
Results:Imaging was less off-focus than last time, but there were still some unusual bright and dim images. We concluded that this could be possibly due to photobleaching. Imaging also showed the presence of multiple layers on our microscopy sample.
June 19
- More Minimal Media was made as per the following formula
Ammonium sulfate 1.0g500mL
Dipotassium phosphate 7.0g/500mL
Monopotassium phosphate 3.0g/500mL
Sodium Citrate dihydrate 0.5g/500mL
Magnesium Sulfate 0.1g/500mL
- J40001 was diluted in minimal media
500uL Seeding to 5mL dilution
5mL Minimal Media
0.5mL dextrose
50uL yeast
5uL AMP
- Imaging was conducted with the addition of IPTG and AHL on the plate reader to ensure that the oscillator was in fact sensitive to such parts. From stock powder, the AHL was diluted in ethanol and stock aloquots of 10 000X were made. Thus, a 10X dilution must first be made for the intermediate stock to which 1uL of this solution is added to 1mL of the working solution to yield a final concentration of 1-2uM. The preparation of the DOX was similar however to a concentration of 1000X so 1uL per mL can be added to the working solution to yield a final concentration of 10nM. In addition, the stock IPTG can also be added as 1uL per mL. For the imagining, both a dilute (1000uL MM) and concentrated (350uL MM) sample was made and the appropriate amounts of suppplements were added. The samples were placed in the plate reader for 2 hours and images were taken every 5 minutes. Further, the diluted sample was placed in the plate reader and it, along with the previous samples, were left for a further 3 hours.
Results
Weak osscilations were noted though their nature makes the results inconclusive to whether actual oscillations are occuring (yet the possibility is still present). The diluted sample presented more promising results but further testing of the system is necessary.
July 2007
July 1
- Diluted seedings of I+J (in supp. M.M.), J40001, I15004 (in Top10 cells with LB), I5610.
- To the dilutions, after an O.D. of 0.2-0.3 was reached, IPTG/DOX/AHL were all added to each biobrick dilution, and another dilution was left as a control. <p>
Results: I5610 (repressilator) did not show any fluorescence in the confocal microscope.
J40001 showed some fluorescence.
The samples of I+J, J & I in AHL/DOX/IPTG were then left longer in incubation and then viewed on the confocal again.
Results: I5610 again showed no fluorescence, J40001 very little, and the I+J was continually drifting, we concluded that this was probably due to an illumination problem of the microscope equipment itself and not the DNA.
- Seeded I+J in supp. M.M. again for the plate reader experiment tomorrow.
July 3
- A superconcentrated midiprep of the I5610 cells was done as following the elution of the plasmid, the DNA was all pooled into 1mL of ethanol this making it doubly concentrated.
- A large-scale digest of I15004 was conducted using the following formula
10uL buffer
0.5uL BSA
20uL DNA
17.5uL water
1uL SpeI
1uLXbaI
Following the digest, a gel extraction was conducted to isolate the I insert and the DNA was stored in the freezer. Unfortunately, the cuts may have severed the resistance of the insert thus it cannot be used in further ligation steps. Alternatively, a PCR of the plasmid will be done to isolate the insert to be ligated into another plasmid with a high copy number.
- A further transformation og I5610 into MC4100 cells was repeated with a 2 minute HS and plated on AMP/Kan plates as the previous attempt at imaging showed no florescence indicating a bad tranformation or DNA sample.
- I+J were viewed on the plate reader at different concentrations (in 350ul M.M. and in 1ml M.M.) after reaching an O.D. between 0.2-0.3 and a series of consecutive washings in MM. A kinetic reading was then taken over 2 hours, with 5 minute intervals, with a high sensitivity and at 32C. The excitation wavelength as set to 430nm and the emission wavelength was set to 475nm. A transparent cover was placed atop the plate reader to prevent drying out over the testing period.<p>
Results: The were possibly oscillations at both high and low concentrations, with a greater change in the diluted I+J. The results seemed to show only the end point of the oscillation, where the graph levels off.
- A third plate reading experiment was done with a newer batch of O.D.'d I+J cells, to see a pull cycle of oscillations. The results seemed promising, however, after showing it to Jay, she concluded that the fluorescence intensities were too random to be substantial.
July 4
- A large scale digest was done again, this time using different restriction enzymes (XbaI & BanII), with cuts at 1.8Kb and 3.8Kb on a 5.6 Kb plasmid. The digest was then run on a gel with large wells for 1h20mins. When viewed on the computer, the cuts were precise and the bands were clear.
We then proceeded with gel extraction in the evening after cutting out the I15004 insert. However the I15004 extraction was useless as we later found out that the restriction enzymes used also cut some of the Kan antibiotic resistance from the plasmid, thus making the insert unusable. - Seeded I+J in supplemented Minimal Media.
- As there were no more miniprepped J brick in the freezer, we had to seed a few more colonies from a June 1st transformation of the brick, in LB.
July 5
- I5610 seeding from yesterday were diluted 20X in supplemented MM and grown to an OD of 0.2-0.3 for imaging. Upon investigation under the microscope, no florescence was present under the new YFP filter thus again, the represillator appears to be inactive.
- J-brick from the old June 1st plates were again seeded in LB and grown overnght in the IS.
July 6
- Imaging on the MNI confocal was not successful because the sample kept drifting out of focus (or is it the microscope that can't keep focus?).
- Imaging on the 5th floor confocal also showed that the focus was changing under bright field. The sample was not showing any fluorescence, though (bad colony?).
- On Monday, we need to determine if it is the microscope or the sample that is causing the problem. We need some fixed bacterial slides to look at.
- Ordered Streptomycin, primers for the isolation of the I-insert and CcdB resistant cells from invitrogen.
Cloning Strategy for I15004 in pSB1AK3
A. Vector Preparation
1. Transform psb1AK3 in OneShot CcdB resistant cells
2. Plate on Streptomycin plates
3. Miniprep
4. Digest with EcoRI and PstI
B. Insert Preparation
1. PCR I15004 gene with standar biobrick primers
Primers: Forward: 5’ attaccgcctttgagtgagc 3’ | Reverse: 5’ tgccacctgacgtctaagaa 3’
2. PCR Purification
3. Digest with EcoRI and PstI
C. Ligation
1. Prepare an insert:vector ratio of ~1:3
2. Perform Ligation
D. Transformation
1. Into MC4100 cells (with J brick too)
July 8
Seeded 3 colonies of J40001 again from the same plate (June 1st, 100ul volume) in 1X LB and Amp.
July 9
- Transformation of J-brick from the biobrick plates into Top 10 cells. HS of 2 min with 3uL of DNA was conducted.
- Transformation of the I5610 from the biobrick DNA was also conducted into MC4100 cells in a final attempt to see florescence.
July 10
- Seeding of J40001 and I5610 was done.
July 11
- Miniprep of J40001 for use to make more I+J oscillating systems.
- Restriction Digest of the J brick was conducted with EcoRI and PstI and its presence was confirmed
- A PCR was also conducted (as per Elvis' protocol) in attempt to amplify the I15004 insert from the standard primers ordered from MIT. The protocol appears in the protocol section.
- ccdB cells arrived for the tranformation of the new pSB1AK3 plasmid and these were diluted to 100mL in preparation for the chemically competent cells proceedure tomorrow.
July 12
- Chemically competent cells were made (following Annette's protocol) of the ccdB cells.
- Transformation of the pSB1AK3 plasmid into these cells was then preformed and plated on AMP/KAN plates. After grown overnight, there was only a single colony indicating that the home-made cells were indeed incompetent or the transformation was bad. A new protocol specific for the transformation of ccdB cells was found and utilized the next day.
- A PCR purification was also preformed as found on openwetware (see protocol section again) and following a large-scale gel, no bands were present meaning that the insert was not amplified or simply lost during the purification step.
July 13
- pUC19 was transformed into the homemade cc ccdb cells to test the efficiency using the modified transformation protocol. Upon overnight growth, less then 5 colonies on two plates (each with 100uL of diluted solution) was presented so the competency of the cells has somewhere been compromised; thus, the commercial cells will be used from now on.
- A I+J transformation was also conducted and plated on amp/kan plates.
- The PCR was also repeated using Elvis' protocol though the apparently proper annealing temperature of 51 degrees was used.
July 15
- made AMP
- Amplyfied cc cells
- PCR I-brick
PCR steps (IGEM) 1.heat to 95 5 mins 2.cool to 57 then 1 min pause 3.heat to 72 then 1 min pause 4. cycle again
- I+J was transformed into MC cells
- pUC was transformed into ccDB cells used 2 different heat shocks time
July 17
- made LB and dH2O
- AMP-KAN plates were made. agarose was taken form 7th floor lab
- Ran a gel
- I+J was also seeded in Supp.M.M for imaging
- pSB1AK3 was seeded in 1x LB
- I15004 was miniprepped for a large scale digest
An unexpected band was found at 1.2 kb
July 23
- Miniprepped I-brick
- Then it was digested with
a) Afe I, Pst
b) Ban II, Xba I\
- pSB1AC3 was transformed into ccdB cells
- I+J was seeded
- AMP-CAN and AMP-CAN-KAN plates were made
AMP: 1ul/ml
CAN: 0.8ul/ml
