USTC/Repressor Evolution on Plates
From 2007.igem.org
Contents |
Why to design repressor-operator pairs
We have been attempting to construct several artificial repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site, and by means of protein design. We decide that they should be newly designed for three reasons,
- The number of natural regulators well studied is limited.
- Natural regulators do have some disadvantages.
- For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted.
- There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations.
Start: Lac repressor
Selection of operator sequence
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity,. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome.
O1 aattgtgagcgctcacaatt O2 aattgtaagcgcttacaatt O3 aattgtaaacgtttacaatt O4 aattgtgaacgttcacaatt
Repressor design
Figure 2 shows the recognition region of which the amino acid residues we will try to modify. We attempt to minimize the binding energy of DNA and protein between the recognition region and the target operator to find the optimal composition and arrangement of the amino acid residues of the recognition regions.
With this computational method in silicon, we are able to screen thousands of proteins in a faster and cheaper way, compared with the traditional wet experimental methods.