Melbourne/Plan:Gas vesicles
From 2007.igem.org
< Melbourne
Revision as of 23:38, 19 July 2007 by PhillipDodson (Talk | contribs)
Preliminaries
- Usefull links (restriction enzymes)(Software)<open wetware primer design> <more primer design>
- Sequences:
- Ncbi genebank AF053765 (pNL26 7371bp) (pNL29 6036bp) [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] (FASTA seq.)
- pBluescriptIIKS+ [http://www.stratagene.com/products/displayProduct.aspx?pid=267 (stratagene) ][http://www.stratagene.com/vectors/sequences/pbl2ksp_s.txt (sequence) ] [http://www.stratagene.com/vectors/restriction_sites/pbl2ksp_r.txt (restriction map) ][http://www.stratagene.com/vectors/maps/pdf/pBluescript%20II%20KS+_%20webpg.pdf (map) ] [http://www.stratagene.com/manuals/212205.pdf (Manual)]
- (no spaces sequence 2961bp)
- HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701 ,Xbal cuts at 677 ,SpeI cuts at 683
- (no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)
- pNL26 Plasmid with insert: (seq 10318bp) (res map) (digests) (reverse complement)
- pNL26 insert PstI--HindIII:(pNL26 7371bp)
- pNL29 Plasmid with insert: (seq 8983bp) (res map) (digests) (reverse complement)
- pNL29 insert PstI--HindIII:(pNL29 6036bp)
- Frame arrangement for Biobrick protein expression.
- Biobrick expression plasmid system.
- Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations
- design primers
- create registery parts
- pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators.
- pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU
- design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required.
- create registery parts
- Other investigations
- Locate putative transcription terminators.
- Locate putative ribosome binding sites.
- Locate putative regulation sequences/ promotors.
- Confirm putative genes.
- Blast search homology of each putative ORF & gene.
- Produce phylogenic maps of Gvps.
Steps:
- Recovery of genes: (2 days)
- Recover the plasmid from paper provided into solution.(method)
- Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock)
- pick 3 colonies of each
- Overnight Culture x9(6 above and 3 form agar block provided)
- Miniprep
- Produce glycerol stocks
- Confirm presence in recovered sample using digest.(HindIII)
- ->Established Supply of Plasmid
- Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days)
- Confirm transcription RT-PRC,
- Confirm translation (buoyant phenotype method).
- Confirm translation (Namarski optics (direct interferance contrast microscopy method).
- Removal of four biobrick like restriction sites all in GvpL.
- DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon (result)
- (Quickchange XL Kit)[http://www.stratagene.com/sdmdesigner/default.aspx (Primer design program) ] [http://www.stratagene.com/downloads/qc/200521.pdf (Manual)](Primer program output)
- EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)]
- Replace with [GA A][AAT][TC A] Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%).
- PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)]
- Replace with [CTG][CAA] Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- XbaI [TCTAGA] (not present)
- SpeI [ACTAGT] (not present)
- Insertion of biobrick required restriction sites by PCR primer modification.(method)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
- PREFIX Primer 3cctttctagag5 11 bp adds XbaI
- SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I)
- In Frame for expression when combined with Lac promotor.
- Primer generation
- Plasmid extraction from culture
- PCR
- Restriction EcoR1 & Spe1
- Gel separation
- Restriction of standard Library death plasmid EcoR1,Spe1.
- Ligation.
- Transform host with regulated POPS output
- Confirm dna, rna , protein (as for A)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
supplementary material for use in experiments
- pNL26 parts:
- GvpA (DNA sequence) (protein sequence)
- EcoRI restriction site 7089 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
- coden pair change: Isoleucine T57C: [ATT](K12 usage 30%) to [ATC](K12 usage 25%).(adds EcoRV)
- Primer
- GvpA (DNA sequence) (protein sequence)
- GvpP (DNA sequence) (protein sequence)
- PstI restriction site 6389 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
- coden pair change:Glutamine G441A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer
- GvpQ (DNA sequence) (protein sequence)
- PstI two restriction sites 6136 & 6169 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
- coden pair change:Glutamine G150A,G183A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer #1
- mutation primer #2
- ORF1 (DNA sequence) (protein sequence)
- GvpP (DNA sequence) (protein sequence)