I716334 (ThpD)

From 2007.igem.org

Revision as of 00:33, 9 August 2007 by Nnguyen (Talk | contribs)

(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

PCR ThpD F/R on ThpD (916bp, BglII/XhoI)
Sub into pBca9145-Bca1144 (BglII/XhoI, 2054+910 L)
Product is I716334

ThpDF Forwar BglII site anneals to ThpD cggatAGATCTatgaccaccgaagtacgcgc

ThpDR Reverse XhoI site anneals to ThpD gtcagctcgagctacttcaccggggtgaagt

Retrieved from "http://2007.igem.org/wiki/index.php/I716334_(ThpD)"