I716331 (ThpA)

From 2007.igem.org

Revision as of 00:35, 9 August 2007 by Nnguyen (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

PCR ThpA F/R on ThpA (553bp, BglII/XhoI)
Sub into pBca9145-Bca1144 (BglII/XhoI, 2054+910 L)
Product is I716331



ThpAF Forward BglII site anneals to ThpA cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg

ThpAR Reverse XhoI site anneals to ThpA anneals to XhoI cgcatctcgagtcaggtggcgaacgggccta