1ORE-CYCtata

From 2007.igem.org

Revision as of 16:50, 25 October 2007 by Giov1984 (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

1ORE-CYCtata is 300bp long and this is its sequence:

ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca


1ore promoter .jpg

In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker

Retrieved from "http://2007.igem.org/wiki/index.php/1ORE-CYCtata"