ThpB

From 2007.igem.org

Revision as of 17:55, 2 July 2007 by Nnguyen (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

PCR ThpBF/ ThpBIR on ThpB (610 bp, gp=A)
PCR ThpBR/ ThpBIF on ThpB (712 bp, gp=B)


PCR ThpBAF/ThpBAR on A+B (1285bp BglII/XhoI)
Digest BglII/XhoI
Product pBca9145-BBa I716331


ThpBF Forward BglII site anneals to ThpB ctagaAGATCTgtgaccatcaccccgcccgc
ThpBIF Removing XhoI site in ThpB ggttcgagcggctcctTgaggaccagggctccggac
ThpBIR Removing XhoI site in ThpD gtccggagccctggtcctcAaggagccgctcgaacc
ThpBR Reverse XhoI site anneals to ThpB cgtcactcgagtcaggccgtttcgcggacgc

Retrieved from "http://2007.igem.org/wiki/index.php/ThpB"