1ORE-CYCtata

From 2007.igem.org

(Difference between revisions)
 
(3 intermediate revisions not shown)
Line 1: Line 1:
-
1ORE-CYCtata is long 300pb and this is it's sequence:
+
1ORE-CYCtata is 300bp long and this is its sequence:
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca
ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca
Line 7: Line 7:
[[Image:1ore promoter .jpg]]
[[Image:1ore promoter .jpg]]
-
In this photo you can see the result of our PCR.Our fragments of amplification are localizated under the band of Dna Marker long 0.5Kb
+
 
 +
In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker

Latest revision as of 16:50, 25 October 2007

1ORE-CYCtata is 300bp long and this is its sequence:

ccgagatggctcgaccatctcggtgttaatactattatcccgagatggctcgagcagatccgccaggcgtgtatatagcgtggatggccaggcaactttagtgctgacaca tacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttata cattaggtcctttgtagcataaattactatacttctatagacacgcaaaca


1ore promoter .jpg

In this photo you can see the result of our PCR.Our amplification fragments are localizated at the level of the 0.5Kb band of the 1 Kb Dna Marker