From 2007.igem.org

Hcole 13:32, 21 June 2007 (EDT) Since my wiki is the only one currently working out of the high schoolers I have volunteered to write up summary of our first week of training so here it goes: On our first day (6/11/07) we went over the basic oligo tutorial and the overview of cloning the Chris made ( to view these follow this link http://www.openwetware.org/wiki/Arking:JCAOligoTutorialHome ) The overview discusses cloning both verbally and pictorially, I found it very helpful in gaining a basic visual understanding of what we will be doing this summer. We worked as a group to complete the tutorial quiz on construction files and designing oligos. We also discussed how PCR works, restriction enzymes inserts etc. and how to use ApE. Next we watched some videos filmed at the undergrad training. They essentially outlined the project that our iGEM team will be working on and the different divisions of work that people would be doing. On 6/12/07 we got into the actual experimental process of cloning. As part of our training we were going to complete as a group a cloning from start to finish. Amin led us through the first process PCR. First we discussed what exactly PCR does then Amin outlined the key components of PCR template, primers, nucleotides, and enzymes. Next we went over the "recipe" of the PCR so how much of each component we needed the concentration of buffers etc. Amin also told us about the proper handling of the materials by showing us where they needed to be stored and the temperatures needed to maintain our components. We also went over the order in which the components need to be added usually from largest volume to smallest but always put buffer in last. Our plasmid, template, and primers were given to us by Lane and they are part of his research. So once we put all the components in the tubes we put them in the PCR machine for 2 hours. We went to lunch and then came back to clean our PCR product. We used a DNA recovery kit. The entire process involves adding solution from the kit centrifuging 3 times, ( 2 wet IE with water, and once dry) elution with water, and centrifuging it to "catch" the DNA. The next day ( 6/13/07) was a busy day. We started by digesting our insert and plasmid in the restriction enzymes BglII and XhoI once again we learned the proper volumes of each component of digestion to use once we'd made our solution we incubated it. About 2 hours later we got out our digests and added them to an agarose gel. We later extracted them from the gel after locating them on the gel. We had to melt our extracted DNA because it was still in gel form. After the gel had melted we began the ligation process when we join our insert and plasmid together. After ligation we checked our ligation product on a gel to see if it had the right number of bp (base pairs). Next we had to get our plasmid containing our gene into E. Coli. To get the product through the membrane we heated up the bacteria with the plasmid/insert allowing the plasmid/insert to enter the bacteria. Then we cooled them to make sure the bacterias membrane was no longer penetrable. Then we let them grow on a plate overnight. When we came back on 6/14/07 we had colonies. Next we performed a colony PCR to see if out insert was actually in the bacteria. After placing our PCR product in a gel we discovered that our bacteria might have the insert since the PCR product had the right number of bp. We wanted to send our plasmid/insert in for sequencing so we grew our bacteria in a liquid medium overnight. On 6/15/07 we took our liquid grown bacteria and started mini prep so we could send it in for sequencing. In order to do this we had to remove our plasmid from the bacteria we had to lice them or break the membrane which is essentially what mini prep does. Placed primers on our plasmid that would show the people sequencing it what point to start from and what direction to go. On 6/18/07 we got our sequences back. It took a loooooooooooooooooooong time to sequence check the sequences mostly because our primers were poorly designed which cause a lot of mutations in our final product. Sadly none of the mutations were silent so we did not get the product we wanted. We spent just over half our day trying to sequence our inserts. That afternoon we got started on the Single Internal Restriction Sites tutorial (you can find it in the link I gave you). We sent in our construction files for that to Chris. We also did the oligo tutorial again but this time individually. On 6/20/07 we went over any mistakes we had made in the tutorials. This essentially concluded our training. We did more stuff on 6/20/07 but I'll explain that in my next entry.

Hcole 14:48, 21 June 2007 (EDT)

On to the second half of 6/20/07! We finally got the genes we'll be focusing for the next week or however long it takes us to complete cloning. I will be working with H-NOX. For more info on H-NOX and what it does check out these research papers http://www.jbc.org/cgi/content/full/282/2/897 http://www.chemistry.ucsc.edu/teaching/Chem200A/Fall06/PaperLIst_files/MarlettaNO.pdf So once we recieved the sequences of our genes from Chris. The sequence for H-NOX looks like this ATGAAGGGGACAATCGTCGGGACATGGATAAAGACCCTGAGGGACCTTTACGGGAATGATGTGGTTGATGAATCTTTAAAAAGTGTGGGTTGGGAACCAGATAGGGTAATTACACCTCTGGAGGATATTGATGACGATGAGGTTAGGAGAATTTTTGCTAAGGTGAGTGAAAAAACTGGTAAAAATGTCAACGAAATATGGAGAGAGGTAGGAAGGCAGAACATAAAAACTTTCAGCGAATGGTTTCCCTCCTATTTTGCAGGGAGAAGGCTAGTGAATTTTTTAATGATGATGGATGAGGTACACCTACAGCTTACCAAGATGATAAAAGGAGCCACTCCTCCAAGGCTTATTGCAAAGCCTGTTGCAAAAGATGCCATTGAAATGGAGTACGTTTCTAAAAGAAAGATGTACGATTACTTTTTAGGGCTTATAGAGGGTAGTTCTAAATTTTTCAAGGAAGAAATTTCAGTGGAAGAGGTCGAAAGAGGCGAAAAAGATGGCTTTTCAAGGCTAAAAGTCAGGATAAAATTTAAAAACCCCGTTTTTGAGTATAAGAAAAATTAA We had to make primers so we could order them that afternoon. I decided to cut with BglII and XhoI so my primers look like this Forward:ctagtAGATCTATGAAGGGGACAATCGTCGG Reverse: cgtgaCTCGAGgaatgGGATCCTTAATTTTTCTTATACTCA The plasmid I will be using will be pBca9145-Bca1144 which looks like this :Image:pcatext.txt I will be cutting with BglII and XhoI as I mentioned before. The insert and primers looks like this: The plasmid+insert should look something like this.