http://2007.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=100&target=Ayu&year=&month=2007.igem.org - User contributions [en]2024-03-29T07:54:53ZFrom 2007.igem.orgMediaWiki 1.16.5http://2007.igem.org/wiki/index.php/Arthur_YuArthur Yu2009-04-15T02:17:42Z<p>Ayu: </p>
<hr />
<div>Hi, I'm a UC Berkeley student, MCB 2010!<br><br />
I did iGEM in 2007 on the UC Berkeley team.<br><br><br />
[http://www.openwetware.org/wiki/User:Arthur_K_Yu OpenWetWare]<br><br />
[http://www.ayuyua.com Website]</div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_YuArthur Yu2009-01-22T01:47:59Z<p>Ayu: </p>
<hr />
<div>Hi, I'm a UC Berkeley student, MCB 2010!<br><br><br />
I did iGEM in 2007 on the UC Berkeley team.<br><br><br />
See me at [http://openwetware.org/wiki/User:Arthur_K_Yu OpenWetWare]!</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007Present2BerkiGEM2007Present22007-09-26T08:49:46Z<p>Ayu: </p>
<hr />
<div>sorry for the delay. This is a rough draft. we will finish it soon. <br />
<br />
Streptomyces Chyrsomallus consists of many genes; however, I was only interested in 4 genes and they are thpA, thpB, thpC and thpD. These 4 genes will help initiate the production of hydroxyectioine. The 4 genes should be arranged in this order: thpA-rbs-thpB-rbs-thpC-rbs-thpD. thpD is the gene that plays a crucial role in the production of hydroxyectoine. The other three genes are there to initiate the process. When inserted into a bacterium, hydroxyectoine will prevent dessication and many other extremes. It will protect the bacteria's proteins and cell membrane. <br />
<br />
[[Image:Thp and stuff.png]]<br>revamped pic! [[User:Ayu|Ayu]] 04:49, 26 September 2007 (EDT)<br />
<br />
<br />
Trehalose is pulled right out of the E.coli genome and consists of the genes otsA and otsB. Naturally otsB comes first because the production of that is more important that otsA so in my operon otsB comes before otsA.<br />
Together the sugar Trehalose is produced which helps the cell recover from freeze-drying. OtsB encodes for a 29.1-kDa trehalose-6-phosphate phosphatase and otsA encodes for a 53.6-kDa trehalose-6-phosphate synthase. Together they make up a Saccharomyces cerevisiae trehalose-6-phosphate synthase/phosphatase complex. Naturally, the 3' end of the otsB coding region overlaps the 5' end of the otsA coding region by 23 nucleotides. The Trehalose helps the frozen dehydrated cells to recover back to a functioning hydrated state. Not all cells survive the freeze drying process but Trehalose increases the rate of success. Trehalose structure:</div>Ayuhttp://2007.igem.org/wiki/index.php/File:Thp_and_stuff.pngFile:Thp and stuff.png2007-09-26T08:42:36Z<p>Ayu: </p>
<hr />
<div></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007Present2BerkiGEM2007Present22007-09-26T08:42:26Z<p>Ayu: </p>
<hr />
<div>sorry for the delay. This is a rough draft. we will finish it soon. <br />
<br />
Streptomyces Chyrsomallus consists of many genes; however, I was only interested in 4 genes and they are thpA, thpB, thpC and thpD. These 4 genes will help initiate the production of hydroxyectioine. The 4 genes should be arranged in this order: thpA-rbs-thpB-rbs-thpC-rbs-thpD. thpD is the gene that plays a crucial role in the production of hydroxyectoine. The other three genes are there to initiate the process. When inserted into a bacterium, hydroxyectoine will prevent dessication and many other extremes. It will protect the bacteria's proteins and cell membrane. <br />
<br />
[[Image:Thp and stuff.png]]<br />
<br />
Trehalose is pulled right out of the E.coli genome and consists of the genes otsA and otsB. Naturally otsB comes first because the production of that is more important that otsA so in my operon otsB comes before otsA.<br />
Together the sugar Trehalose is produced which helps the cell recover from freeze-drying. OtsB encodes for a 29.1-kDa trehalose-6-phosphate phosphatase and otsA encodes for a 53.6-kDa trehalose-6-phosphate synthase. Together they make up a Saccharomyces cerevisiae trehalose-6-phosphate synthase/phosphatase complex. Naturally, the 3' end of the otsB coding region overlaps the 5' end of the otsA coding region by 23 nucleotides. The Trehalose helps the frozen dehydrated cells to recover back to a functioning hydrated state. Not all cells survive the freeze drying process but Trehalose increases the rate of success. Trehalose structure:</div>Ayuhttp://2007.igem.org/wiki/index.php/File:Thp_and_stuff.jpgFile:Thp and stuff.jpg2007-09-26T08:42:05Z<p>Ayu: </p>
<hr />
<div></div>Ayuhttp://2007.igem.org/wiki/index.php/File:072007_yfbEgraph_fix.jpgFile:072007 yfbEgraph fix.jpg2007-09-26T07:59:38Z<p>Ayu: </p>
<hr />
<div></div>Ayuhttp://2007.igem.org/wiki/index.php/Jamboree/DNA_SubmissionJamboree/DNA Submission2007-09-26T07:57:08Z<p>Ayu: 8-tube strip and single tube were mixed up</p>
<hr />
<div>{{TOCright}}<br />
<font color=red><small>'''We are still adding information to this page. Feel free to read through it but keep in mind that you should check back often for more updated information!'''</small></font><br />
<br />
==iGEM 2007 Part Submission==<br />
<br />
In order to qualify for winning any part-related awards at the 2007 iGEM Jamboree, the teams must document their parts according to the [https://2007.igem.org/Jamboree/Compete#Part_Documentation_on_the_Registry Park Documentation Guidelines] as well as submit the physical DNA to the Registry. Following these guidelines will begin the part promotion process to get your part elevated to the '''Accepted''' rating level. Only parts that are at the Accepted rating level will be considered for awards. <br />
<br />
For iGEM 2007 we are accepting part submissions in the form of miniprepped DNA. There is an online submission form that must be completed in order to start the DNA submission process (see more details below) [PROVIDE LINK TO FORM]. Each part will go through a physical DNA screening/quality control process, in addition to the part documentation review process, before it is accepted into the Registry. We will also provide online status updates for each part during the submission process so that the part creator can find out at what stage of the screening process their part has gone through.<br />
<br />
<br />
===Part Documentation Guidelines===<br />
All the documentation for your parts is expected to follow the guidelines set by the Judging Committee. The Registry will also provide more elaborate part documentation guidelines that you may want to keep in mind when documenting your parts. Following these expanded guidelines will be necessary in order for parts to start the Part Promotion process and be promoted to Accepted parts. For more information on the Registry Part Promotion process see [http://partsregistry.org/Part_Promotion_Process this Registry page] for a brief explanation. A more detailed explanation of the Part Promotion process will be provided soon. <br />
<br />
<br />
<br />
===Quality Control Process===<br />
In order to assess the quality of the parts accepted into the Registry, we will perform a standard set of experiments with a focus on verifying the length of the insert. In addition we will aim to validate the declared antibiotic resistance of each part.<br />
<br />
The quality control process is comprised of the following tasks:<br />
*'''Transform''': we will transform each sample of DNA into our standard cell strain, Top10<br />
*'''Pick/Inoculate single colony''': after transforming the DNA into Top10 cells, we will pick a single colony and inoculate into the antibiotic specified by the creator. We will also inoculate that colony into the rest of our standard antibiotic set (Ampicillin, Chloramphenicol, Tetracycline, Kanamycin) and watch for growth in the correct antibiotic<br />
*'''Miniprep ''': the bacterial culture grown in the specified antibiotic will be miniprepped to isolate plasmid DNA<br />
*'''Digest ''': the miniprepped plasmid DNA will be cut with EcoRI and PstI to cut out the insert from the plasmid<br />
*'''Gel''': the digested plasmid DNA will be run on an Invitrogen E-gel to visualize the insert and the plasmid. From this gel we can tell whether the part length corresponds to the length designated by the designer. <br />
<br />
If the part length as detected on the E-gel corroborates what the designer has specified in the part documentation AND if the antibiotic testing is consistent with the expected antibiotic growth pattern, the physical DNA for the submitted part will be deemed '''Accepted.'''<br />
<br />
<br />
<br />
===Online Submission Form===<br />
In order to accept physical DNA submission from teams in an organized fashion, we will be requiring teams to complete an online DNA submission form. The form is comprised of four parts:<br />
<br />
====Part Specification page====<br />
<br />
This page is the first page you will come to when you access the online submission form. You will need to specify which one of the four formats you are sending your parts in to the Registry: <br />
[[Image:Minicentrifugetube.jpg|thumb|left|Single PCR tube]]<br />
'''Single PCR tube''' - If you are sending less than 4 samples, you may use the single PCR tube format to send in the physical DNA for your parts. The tube(s) must be wrapped with lab tape with the sequential number of the part written in permanent marker on tab of tape (this number is NOT the part number - it is the number of the sample i.e. #1, #2, #3, #4). When submitting 8-tube strips you must ship them in 50ml Falcon tubes. This format requires a total of 20ng of miniprepped DNA in a final volume of 10ul per sample.<br />
<br><br />
<br><br />
<br><br />
[[Image:Pcrtubes.jpg|thumb|right|8-tube strip]] '''8-tube strip''' - To send more than 4 parts at a time, use the 8-tube strip format. Wrap lab tape around the first tube in the sequence then write the part sequential number (see above) on the lab tape tab. When submitting 8-tube strips you must ship them in 50ml Falcon tubes. Each Falcon tube can hold 2 8-tube strips. ''Using the 8-tube strip format requires a total of 20ng of miniprepped DNA in a final volume of 10ul per sample.'' <br />
<br style="clear:both;"/><br />
'''96-well PCR plate''' - [[Image:96_well_plate.jpg|thumb|right|96-well plate with adhesive foil lid]]If you are submitting a large number of samples you may wish to submit the DNA in 96-well PCR plate formate. You need to add the samples in the correct order. Start with well 1A and work your way down the first column. Then continue on to well 2A and down that column. Proceed in this fashion until you have added all of the samples that you are submitting. Wrap the well 1A with lab tape to provide yourself as well as the folks at the Registry with a visible marker as to where to start processing samples. ''Using this format requires that you submit 20ng of miniprepped DNA in a final volume of 10ul per sample.'' <br />
<br><br />
<br><br />
'''Filter paper grid''' - [[Image:Filter_grid.jpg|thumb|left|Filter paper grid with punching tool]]We have put a lot of effort into testing the use of high quality paper as a method by which to send DNA. The Registry will be sending each team several paper grids onto which they can spot their DNA. You must combine 1.6ul of DNA at 100ng/ul with 0.4ul of 1% Cresol Red dye and spot the resulting 2ul in the middle of the box into which you are spotting your DNA. Begin with box 1A, continue down column 1, continue on to box 2A and down that column. Proceed in this order until you have finished spotting all of the samples that you are submittin. ''You will end up submitting at least 160ng total for each sample.''<br />
<br style="clear:both;"/><br />
<br />
After choosing which method for DNA submission you will use, you will need to enter the Registry part numbers for each sample. Enter the part numbers in the order in which you will be sending the DNA. By default this page will only 8 text fields into which you can input your part numbers. If you are submitting more than 8 parts, click on the appropriate button to '''Add more parts.'''<br />
<br />
Once you have finished entering the part numbers for all of the parts that you are submitting, click on the '''Proceed to fill in part details''' button. This will take you to the next portion of the online submission process.<br />
<br />
====Part Detail page====<br />
<br />
The part detail page is where you will do just that - add all of the details for each of the parts that you will be submitting! There are 5 criteria that we require for each part being submitted. <br />
<br />
*'''Part number''' - As you have already entered the part number on the preliminary part specification page, this field will be automatically filled in for you. Do double-check, however, to make sure that the part numbers that have been filled in correspond to the part numbers for which you are entering the details. <br />
<br />
*'''Plasmid''' - You will be able to choose the plasmid that your part is in from a pull down menu that lists all of the plasmids documented on the Registry. IMPORTANT: If for some reason the plasmid that your part is in does not appear on the pull down menu you must first enter the plasmid into the Registry. Instructions on how to add a plasmid to the Registry can be found HERE. <br />
<br />
*'''Total ng of DNA provided''' - Please provide the total amount of DNA (in ng) that you are submitting to the Registry. This DNA must be miniprepped and we require at least 20ng of DNA in a final volume of 10ul (concentration of 2ng/ul). For filter paper grids we require at least 0.16ug of DNA.<br />
<br />
*'''DNA format''' - While we encourage you to submit DNA in liquid form, you may provide dry DNA if you wish. Please indicate in this field which format you are sending the DNA in. <br />
<br />
*'''Sequenced''' - Please tell us whether you have sequenced this DNA or not. Even you if you haven't sequenced the DNA that you are submitting, the sequence MUST be in the part documentation. See THIS PAGE for the part documentation rules. <br />
<br />
The part detail page is also where you will provide the tracking number for the shipment of parts that you are sending the Registry. This tracking number is mandatory. It allows the ability to see whether the parts that you sent are stuck in customs, therefore delaying your part submission. Please provide the tracking number as well as the carrier that you are using, e.g. DHL 012345678.<br />
<br />
====Part Shipment Review page====<br />
After entering all of your part details you are given the opportunity to review all of the information that you are about to submit to the Registry. Take a look at all of the part details and make sure they are correct. At this point you can either click the Edit button to go back to edit any of the details or press the submit button to finalize your DNA submission. <br />
<br />
====Part Shipment Completion page====<br />
Once you click on the Submit Part Shipment button to finalize your submission you will come to a page that shows that you have successfully submitted your part shipment. You will also see a review of your part details that you entered on the part detail page. At this point you may want to print this page to have a record of the parts that you have submitted. Keep track of your part shipment number and check back to see what stage your submission is in (see below for details). <br />
<br />
<br />
<br />
<br />
===Physical DNA Submission: Submission status===<br />
We want you to be fully aware of the status of your part while it is going through the Registry QC process. For this reason we are creating the ability for you to check back and see what stage your is at. You will be able to see:<br />
<br />
* when we have received the DNA<br />
* when the part has begun the QC process<br />
* when the part has successfully completed the QC process<br />
* if the part did not complete the QC process, you will see when we are waiting for you to send us another sample of the part<br />
<br />
<br />
<br />
===Part Shipping Materials: ordering information===<br />
Single PCR tubes: '''Axygen''' [http://www.axygen.com/jsp/coreIdDetail.jsp?coreId=MCT060 MCT-060-C-S]<br><br />
8-tube strips: '''Axygen''' [http://www.axygen.com/jsp/coreIdDetail.jsp?coreId=PCR0208 PCR-0208-C] or '''BioRad''' [http://www.bio-rad.com/B2B/BioRad/product/br_category.jsp?BV_SessionID=@@@@1422642991.1189446586@@@@&BV_EngineID=ccceaddlmhegdgkcfngcfkmdhkkdflm.0&categoryPath=%2fCatalogs%2fLife+Science+Research%2fAmplification+%7c+PCR%2fPCR+Plastic+Consumables%2fThin-Wall+PCR+Tubes+and+Caps%2fTube+and+Cap+Strips%2fLow-Profile+0.2+ml+Tube+Strips%2f&divName=Corporate&loggedIn=false&lang=English&country=HQ&catLevel=7&catOID=-33540&isPA=false&serviceLevel=Lit+Request&searchStr=TLS+0801&cateName=Ordering+Information TLS 0801]<br><br />
96-well plates: '''VWR''' [https://obi2.vwrsp.com/catalog/product/index.cgi?catalog_number=82006-650&inE=1&highlight=82006-650&from_search=1 82006-650]<br><br />
Filter paper grid: provided by the Registry</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007Present3BerkiGEM2007Present32007-09-21T09:41:15Z<p>Ayu: /* The Controller */</p>
<hr />
<div>'''[[BerkiGEM2007Setup|<< Back to Setup]]'''<br />
<br />
===The Controller===<br />
<br />
The Controller is an integrated genetic circuit, comprised of two plasmids, that directs the initiation and production of the primary systems proteins through its component operons.<br />
<br />
'''Introduction'''<br />
<br />
As with many synthetic biology applications, we wished to be able to control the production of the proteins involved in our system, control the relative amounts of protein produced, and have a large dynamic range between the off and on states of our system. Therefore, we designed our system to accomplish these goals, by enabling the activation of the system through an Iron Promoter and placing our genes under the control of the T7 RNA Polymerase, with T7 promoters of varying strengths. In addition, we placed the primary genes on an Amplifiable BAC, to enable even more dynamic range.<br />
<br />
'''The Two-Plasmid Pir/T7 System'''<br />
<br />
Our controller system is composed of two plasmids: a pSC101 Controller Plasmid, and an Amplifiable BAC.<br />
<br />
<br />
[[Image:Berk-DT Figure 1.png]]<br />
<br />
[[Image:Berk-DT Figure Legend.png]]<br />
<br />
<br />
The pSC101 Controller Plasmid contains both the Self-Destruct Device, as well as the controller operon: The genes pir and the T7 RNA Polymerase under the control of an Iron Promoter. The pir gene activates the R6K origin, which causes the plasmid containing it to jump to high copy - the R6K origin is silent without pir. The T7 RNA Polymerase transcribes genes under the control of T7 Promoters, and will vary with strength depending on the variant of T7 Promoter. The T7 Promoters are silent without the T7 RNA Polymerase, and have a high level of transcription when active.<br />
<br />
The Amplifiable BAC contains all the primary systems production genes, and two origins of replication. It contains both the BAC origin and the R6K origin, and so is single-copy when pir is absent, and high-copy when pir is active. Additionally, the BAC contains all the systems production genes, such as Hemoglobin, Heme (A to D), and the necessary chaperones, reductases, etc. Each of these operons is under the control of a custom T7 Promoter variant, tuned to produce the relative amount of protein desired for each operon. For example, the heme genes are under a weak T7 Promoter, as the heme genes naturally produce a large amount, where not too much is needed. However, the Hemoglobin operon is under a strong T7 Promoter, as we want a large amount of Hemoglobin present to effectively carry oxygen.<br />
<br />
'''Results and Data'''<br />
<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
[ Add Results and More Data Here ]<br />
<!-- As these incredibly awesome figures and charts clearly demonstrate, our system works ridiculously well, with 42 orders of magnitude of dynamic range (approximately). --></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007Present4BerkiGEM2007Present42007-09-21T06:23:39Z<p>Ayu: </p>
<hr />
<div>'''[[BerkiGEM2007Setup|<< Back to Setup]]'''<br />
<br />
===Immunity===<br />
<br />
Inserting most wild-type E. coli into a human system causes rapid sepsis, an undesirable effect that we have eliminated. We have modified carbohydrate markers of our base strain to permit insertion into the bloodstream.<br />
<br />
'''Introduction'''<br />
<br />
White blood cells constantly roam the bloodstream in search of foreign bodies. The human immune system targets potentially infectious bacteria by membrane signature and the presence of antigens (PLEASE ADD CLEAR INFO HERE CHRIS, LIKE THE VERY FIRST INTRO POWERPOINT YOU SHOWED US). Some bacteria, however, are able to evade detection. Our bacteria mimics these characteristics.<br />
<br />
'''O1 Antigen'''<br />
<br />
Salmonella includes this antigen. It allows it to effectively enter humans. We have integrated this gene, known as wbbL (? i hope this is right), into the genome of our bacteria.<br />
<br />
-INSERT YOUR ATTRACTIVE PICTURE HERE-<br />
<br />
'''K Capsule'''<br />
<br />
MR. STRAIN possesses a carbohydrate capsule which further prevents recognition by the human immune system. We have also cloned this gene into our bacteria genome.<br />
<br />
-INSERT OTHER ATTRACTIVE PICTURE HERE-</div>Ayuhttp://2007.igem.org/wiki/index.php/Berkeley_UCBerkeley UC2007-08-16T22:28:00Z<p>Ayu: </p>
<hr />
<div>[[Image:Berkeley_BactobloodHeader.jpg]]<br />
<br />
'''The global demand and importance''' for cheap, available, and disease free blood substitutes is undisputed. There are currently no red blood cell substitutes approved for clinical use in the US or the UK, and whole blood is almost always in short supply. Underdeveloped countries that need blood the most simply don’t have the infrastructure to support donation and storage, in addition a sizeable fraction of the population are disease carriers.<br />
<br />
We have developed an innovative and cheap red blood cell substitute by modifying the E. coli chassis to make it safer to inject into the human bloodstream, and by adding components for oxygen delivery. A modified lipopolysaccharide should significantly (1000-10000x) reduce sepsis activity in the human bloodstream. A hemoglobin mutated to increase OD50 to match that of natural human blood cells after diphosphoglycerase. Heme and cytochrome B5 and B5 reductase complement the hemoglobin. Additional chaperone proteins such as sodC, HPI-katG, map, and AHSP were added to increase hardiness and prolong the half-life of the E. coli in the bloodstream. We are also investigating myoglobin, and potential freeze-drying to preserve E. coli, with OtsA, OtsB, thpA through D (trihelose - ots) (hydroxyectoine).<br> <br />
<br />
<br />
----<br />
<br />
<br />
{| cellspacing="2px" cellpadding="5" border="2" style="padding: 0px; width: 780px; color: navyblue; background-color: lightblue;"<br />
|-valign="top"<br />
|width=189.25px style="padding: 10px; background-color: lightblue; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Members</h3></center><br />
<br />
----<br />
<br />
<br />
'''Advisors'''<br><br />
[[John Dueber]]<br><br />
[http://www.openwetware.org/wiki/User:JCAnderson Christopher Anderson]<br><br />
[http://genomics.lbl.gov/ Adam Arkin]<br><br />
[https://keaslinglab.lbl.gov/wiki/index.php/Main_Page Jay Keasling]<br><br />
<br />
'''Teaching Assistants''' <br><br />
[[Farnaz Nowroozi]]<br><br />
[[Amin Hajimorad]]<br><br />
[[Rickey Bonds]]<br><br />
<br />
'''Undergraduate Researchers''' <br><br />
[[Arthur Yu]]<br><br />
[[Austin Day]]<br><br />
[[David Tulga]]<br><br />
[[Kristin Doan]]<br><br />
[[Samantha Liang]]<br><br />
[[Vaibhavi Umesh]]<br><br />
[[Kristin Fuller]]<br><br />
<br />
'''High School Students''' <br><br />
[[Vincent Parker]]<br><br />
[[Nhu Nguyen]]<br><br />
[[Hannah Cole]]<br><br />
<br />
|width=189.25px style="padding:10px; background-color: #ffffaa; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Resources</h3></center><br />
<br />
----<br />
<br />
<br />
[http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9TxjeURaNm1Vw Oligo List Spreadsheet]<br><br />
[http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9TerIU8gSvKbQ CloneSaver Spreadsheet]<br><br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=Berkeley_UC Our BioBrick Parts]<br><br />
[[BerkiGEM2007_AllConstructionFiles | All construction files]]<br><br />
[[BerkiGEM2007_AllSequencingFiles | All sequencing files]]<br><br />
<br />
''If you need an invitation to the spreadsheets, ask Sam.''<br />
<br />
<br />
'''Tools and Guides'''<br><br />
<br />
[http://www.openwetware.org/wiki/Arking:JCAOligoTutorialHome Biobricks and Cloning Tutorials]<br><br />
[http://pir.georgetown.edu/pirwww/search/pairwise.shtml Pairwise Alignment Online]<br><br />
[http://align.genome.jp/ Multiple Sequence Alignment]<br><br />
[http://en.wikipedia.org/wiki/Help:Wikitext_examples Wiki Formatting Guide]<br><br />
<br />
<br />
'''Useful Links'''<br />
<br />
[http://openwetware.org/wiki/IGEM:UC_Berkeley/2006 UC Berkeley iGEM 2006 OpenWetWare] <br><br />
[http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006 UC Berkeley iGEM 2006 wiki] <br><br />
iGEM wikis: [http://parts2.mit.edu/wiki/index.php/Main_Page 2006], [[Main_Page|2007]]<br><br />
[http://partsregistry.org/Main_Page Registry of Standard Biological Parts] <br><br />
Biobricks Parts Lists: [http://parts2.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&group=iGEM_Berkeley 2005], [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2006&group=Berkeley 2006], [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=Berkeley_UC 2007]<br><br />
[http://openwetware.org/wiki/Arking:JCAOligoTutorialHome Tutorials]<br />
<br />
<br />
|width=300.25px style="padding: 10px; background-color: lightblue; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Notebooks</h3></center><br />
<br />
----<br />
<br />
<br />
[[John Dueber Notebook]]<br><br />
[[Christopher Anderson Notebook]]<br><br />
[[Farnaz Nowroozi Notebook]]<br><br />
[[Amin Hajimorad Notebook]]<br><br />
[[Rickey Bonds Notebook]]<br><br />
<br />
<br />
''Keep your wiki notebooks, sequencing/construction logs, and the registry updated!''<br />
<br />
<br />
[[Arthur Yu Notebook | Arthur Yu's 1337 Notebook]]<br><br />
[[Austin Day Notebook]]<br><br />
[[David Tulga Notebook | David Tulga's Notebook]]<br><br />
[[Kristin Doan Notebook]]<br><br />
[[Samantha Liang Notebook | Samantha's Notebook (June - July 19, 2007]]<br><br />
[[Samantha Liang Notebook2 | Samantha's Notebook (July 20, 2007 - present)]]<br><br />
[[Vaibhavi Umesh Notebook]]<br><br />
[[Kristin Fuller Notebook]]<br><br />
<br />
<br />
[[Vincent Parker Notebook]]<br><br />
[[Nhu Nguyen Notebook]]<br><br />
[[Hannah Cole Notebook]]<br><br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/Berkeley_UC/Project_DescriptionBerkeley UC/Project Description2007-08-16T22:27:44Z<p>Ayu: </p>
<hr />
<div>The global demand and importance for cheap, available, and disease free blood substitutes is undisputed. There are currently no red blood cell substitutes approved for clinical use in the US or the UK, and whole blood is almost always in short supply. Underdeveloped countries that need blood the most simply don’t have the infrastructure to support donation and storage, in addition a sizeable fraction of the population are disease carriers.<br />
<br />
We have developed an innovative and cheap red blood cell substitute by modifying the E. coli chassis to make it safer to inject into the human bloodstream, and by adding components for oxygen delivery. A modified lipopolysaccharide should significantly (1000-10000x) reduce sepsis activity in the human bloodstream. A hemoglobin mutated to increase OD50 to match that of natural human blood cells after diphosphoglycerase. Heme and cytochrome B5 and B5 reductase complement the hemoglobin. Additional chaperone proteins such as sodC, HPI-katG, map, and AHSP were added to increase hardiness and prolong the half-life of the E. coli in the bloodstream. We are also investigating myoglobin, and potential freeze-drying to preserve E. coli, with OtsA, OtsB, thpA through D (trihelose - ots) (hydroxyectoine).</div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurSequencingFilesTemplate:BerkiGEM2007 ArthurSequencingFiles2007-08-16T19:30:11Z<p>Ayu: /* Start 51 */</p>
<hr />
<div>'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 26|Skip to 26 Start]]'''<br />
<br><br />
'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 51|Skip to 51 Start]]'''<br />
{|<br />
|-<br />
|Sample||Date||Plasmid||Clone||Primer||Result||File Link<br />
|-<br />
|AY001||060407 ||pBca9145-Bca1145||#1||ca998||Probably good. Long, ambiguous long AAAAAAA.||[[BerkiGEM2007-Sequencing-AY001 | AY001]]<br />
|-<br />
|AY002||060407 ||pBca9145-Bca1145||#2||ca998||Good.||[[BerkiGEM2007-Sequencing-AY002 | AY002]]<br />
|-<br />
|AY003||061207||pBca9145-HPI/katG (I716253)||A1||ca998||super wrong. Seems like only half of HPI/katG, from the AY004.Sal.katG.HPI-Fx "mutate GAT>GAC (BglII)" til the end, was cloned.||[[BerkiGEM2007-Sequencing-AY003 | AY003]]<br />
|-<br />
|AY004||061207||pBca9145-HPI/katG (I716253)||A3||ca998||generally OK. There is one extra G at 584 in the goal plasmid in the calls file. There is low confidence, but I am not sure what to make of it. Possibly should send for recheck at this point; may be necessary to check the mutation point @1308, and the end portion as well. But based on the miniprep digest run yesterday, this guy has a high chance of being the right one. DECISION: sent as AY007 with G01001 for a reverse check.||[[BerkiGEM2007-Sequencing-AY004 | AY004]]<br />
|-<br />
|AY005||061207||pBca9145-HPI/katG (I716253)||A4||ca998||crazy :( there are big gaps||[[BerkiGEM2007-Sequencing-AY005 | AY005]]<br />
|-<br />
|AY006||061207||pBca9145-wbbL (I716000)||B1||ca998||also crazy||[[BerkiGEM2007-Sequencing-AY006 | AY006]]<br />
|-<br />
|AY007||061307||pBca9145-HPI/katG (I716???)||A3||G01001||Looks good actually, only notable thing is silent point mutation @ 1782 TCG > TCA still S. but the mutation point was just missed by sequencing. I don't think it's necessary to recheck; i have faith the primers worked right. well.. idk. major concern still is the possible addition mutation of a G||[[BerkiGEM2007-Sequencing-AY007 | AY007]]<br />
|-<br />
|AY008||061307||pBca9145-neuS (I716001)||C1||ca998||Forward. Looks great!||[[BerkiGEM2007-Sequencing-AY008 | AY008]]<br />
|-<br />
|AY009||061307||pBca9145-neuS (I716001)||C1||G01001||Reverse. Looks great!||[[BerkiGEM2007-Sequencing-AY009 | AY009]]<br />
|-<br />
|AY010||061407||I716002 (pBca9145-yfbE_promote)||D1||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C||[[BerkiGEM2007-Sequencing-AY010 | AY010]]<br />
|-<br />
|AY011||061407||I716002 (pBca9145-yfbE_promote)||D1||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY011 | AY011]]<br />
|-<br />
|AY012||061407||I716002 (pBca9145-yfbE_promote)||D4||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C. @640 addition of a C||[[BerkiGEM2007-Sequencing-AY012 | AY012]]<br />
|-<br />
|AY013||061407||I716002 (pBca9145-yfbE_promote)||D4||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY013 | AY013]]<br />
|-<br />
|AY014||061507||I716000 (pBca9145-wbbL)||E1||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T @ 812, but read quality is low here. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY014 | AY014]]<br />
|-<br />
|AY015||061507||I716000 (pBca9145-wbbL)||E2||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T at 801. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY015 | AY015]]<br />
|-<br />
|AY016||061807||I716000 (pBca9145-wbbL)||E1||G01001||good||[[BerkiGEM2007-Sequencing-AY016 | AY016]]<br />
|-<br />
|AY017||061807||I716000 (pBca9145-wbbL)||E2||G01001||good||[[BerkiGEM2007-Sequencing-AY017 | AY017]]<br />
|-<br />
|AY018||061807||I716253 (pBca9145-HPI/katG)||A3||ay007||good||[[BerkiGEM2007-Sequencing-AY018 | AY018]]<br />
|-<br />
|AY019||062107||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY019 | AY019]]<br />
|-<br />
|AY020||062107||I716006 (pBca9145-Bca9203 B5red)||G3||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY020 | AY020]]<br />
|-<br />
|AY021||062507||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||looks good||[[BerkiGEM2007-Sequencing-AY021 | AY021]]<br />
|-<br />
|AY022||062507||I716006 (pBca9145-Bca9203 B5red)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY022 | AY022]]<br />
|-<br />
|AY023||062507||I716005 (pBca9145-Bca9229 cytoB5)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY023 | AY023]]<br />
|-<br />
|AY024||062507||I716005 (pBca9145-Bca9229 cytoB5)||H4||ca998||looks good||[[BerkiGEM2007-Sequencing-AY024 | AY024]]<br />
|-<br />
|AY025||062807||I716002 (pBca9145-yfbE_promote)||IB||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY025 | AY025]]<br />
|}<br />
===Start 26===<br />
{|<br />
|-<br />
|AY026||062807||I716002 (pBca9145-yfbE_promote)||ID||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY026 | AY026]]<br />
|-<br />
|AY027||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J1||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY027 | AY027]]<br />
|-<br />
|AY028||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J2||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY028 | AY028]]<br />
|-<br />
|AY029||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J3||ca998||Ptet and wbbL were successfully cloned. neuS, unsure. Possibly neuS is gone since there could be a BamHI site right after wbbL in sequence file.||[[BerkiGEM2007-Sequencing-AY029 | AY029]]<br />
|-<br />
|AY030||071107||I716012 (101-008)||1||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY030 | AY030]]<br />
|-<br />
|AY031||071107||I716012 (101-008)||2||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY031 | AY031]]<br />
|-<br />
|AY032||071207||I716013 (pBca9145-yfbE-rbs-ATG)||1||ca998||V>A right after BglII site. Amino acid change is bad.||[[BerkiGEM2007-Sequencing-AY032 | AY032]]<br />
|-<br />
|AY033||071207||I716013 (pBca9145-yfbE-rbs-ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY033 | AY033]]<br />
|-<br />
|AY034||071207||I716014 (pBca9145-yfbE_solo)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY034 | AY034]]<br />
|-<br />
|AY035||071207||I716014 (pBca9145-yfbE_solo)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY035 | AY035]]<br />
|-<br />
|AY036||071207||I716014 (pBca9145-yfbE_solo)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY036 | AY036]]<br />
|-<br />
|AY037||071307||I716015 (RFP no ATG)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY037 | AY037]]<br />
|-<br />
|AY038||071307||I716015 (RFP no ATG)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY038 | AY038]]<br />
|-<br />
|AY039||071307||I716015 (RFP no ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY039 | AY039]]<br />
|-<br />
|AY040||071307||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet||[[BerkiGEM2007-Sequencing-AY040 | AY040]]<br />
|-<br />
|AY041||071707||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet AGAIN - but the sequencing is extremely mixed.||[[BerkiGEM2007-Sequencing-AY041 | AY041]]<br />
|-<br />
|AY042||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||ca998||T7 promoter, CytB5 and the first part of CytB5Red cloned successfully. 591 it is ambiguous if the base is right or not (CytB5Red) but data from Austin's I716011 sequence suggests that it is good.||[[BerkiGEM2007-Sequencing-AY042 | AY042]]<br />
|-<br />
|AY043||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||G01001||dblTerm and the rest of CytB5Red was cloned successfully.||[[BerkiGEM2007-Sequencing-AY043 | AY043]]<br />
|-<br />
|AY044||072307||I716008||R1||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY044 | AY044]]<br />
|-<br />
|AY045||072307||I716008||R2||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY045 | AY045]]<br />
|-<br />
|AY046||072307||I716008||R3||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY046 | AY046]]<br />
|-<br />
|AY047||072307||I716008||R4||ca998||Ptet intact. RBS appears garbled but it's because N's were not placed in the I716008 for the library. Need to map to check for neuS.||[[BerkiGEM2007-Sequencing-AY047 | AY047]]<br />
|-<br />
|AY048||072307||I716008||R5||ca998||wtf is this lol||[[BerkiGEM2007-Sequencing-AY048 | AY048]]<br />
|-<br />
|AY049||072307||I716008||R6||ca998||half of ptet is missing||[[BerkiGEM2007-Sequencing-AY049 | AY049]]<br />
|-<br />
|AY050||072307||I716008||R7||ca998||wtf is this||[[BerkiGEM2007-Sequencing-AY050 | AY050]]<br />
|}<br />
===Start 51===<br />
{|<br />
|-<br />
|AY051||072307||I716008||R8||ca998||half ptet missing||[[BerkiGEM2007-Sequencing-AY051 | AY051]]<br />
|-<br />
|AY052||072307||I716008||r9||ca998||wtf||[[BerkiGEM2007-Sequencing-AY052 | AY052]]<br />
|-<br />
|AY053||072607||I716012|| ||ca998||M.I.A.||[[BerkiGEM2007-Sequencing-AY053 | AY053]]<br />
|-<br />
|AY054||080607||I716026||V1||ca998||Great||[[BerkiGEM2007-Sequencing-AY054 | AY054]]<br />
|-<br />
|AY055||080607||I716026||V2||ca998||Great||[[BerkiGEM2007-Sequencing-AY055 | AY055]]<br />
|-<br />
|AY056||080607||I716026||V3||ca998||A -> G at position 136 in the sequence file||[[BerkiGEM2007-Sequencing-AY056 | AY056]]<br />
|-<br />
|AY057||080607||I716028||W1||ca998||T->C @ 269, G->T @ 539||[[BerkiGEM2007-Sequencing-AY057 | AY057]]<br />
|-<br />
|AY058||080607||I716028||W2||ca998||deletions and stuff, whoa||[[BerkiGEM2007-Sequencing-AY058 | AY058]]<br />
|-<br />
|AY059||080607||I716028||W3||ca998||Great||[[BerkiGEM2007-Sequencing-AY059 | AY059]]<br />
|-<br />
|AY060||080607||I716029||X1||ca998||Great||[[BerkiGEM2007-Sequencing-AY060 | AY060]]<br />
|-<br />
|AY061||080607||I716029||X2||ca998||A->G @ 531||[[BerkiGEM2007-Sequencing-AY061 | AY061]]<br />
|-<br />
|AY062||080607||I716029||X3||ca998||Great||[[BerkiGEM2007-Sequencing-AY062 | AY062]]<br />
|-<br />
|AY063||080707||I716024 VHb basic part||1||ca998||Great||[[BerkiGEM2007-Sequencing-AY063 | AY063]]<br />
|-<br />
|AY064||080707||I716024 VHb basic part||2||ca998||restriction sites in front are funny||[[BerkiGEM2007-Sequencing-AY064 | AY064]]<br />
|-<br />
|AY065||080707||I716024 VHb basic part||3||ca998||Great||[[BerkiGEM2007-Sequencing-AY065 | AY065]]<br />
|-<br />
|AY066||081407||I716033 (ptet-wbbL-neuS)(F-CmR-F)||1||ca998||lol||[[BerkiGEM2007-Sequencing-AY066 | AY066]]<br />
|-<br />
|AY067||081407||I716033 (ptet-wbbL-neuS)(F-CmR-F)||2||ca998||lol||[[BerkiGEM2007-Sequencing-AY067 | AY067]]<br />
|-<br />
|AY068||081407||I716033 (ptet-wbbL-neuS)(F-CmR-F)||3||ca998||lol||[[BerkiGEM2007-Sequencing-AY068 | AY068]]<br />
|-<br />
|AY069||081407||I716033 (ptet-wbbL-neuS)(F-CmR-F)||4||ca998||lol||[[BerkiGEM2007-Sequencing-AY069 | AY069]]<br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY069BerkiGEM2007-Sequencing-AY0692007-08-16T19:26:38Z<p>Ayu: </p>
<hr />
<div>CCGGCCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTACTAGAAGATCCCGCGGAATTAACCATGGTATATATAATAATCGTTTCCCACGGACATGAAGACTACATCAAAAAATTACTCGAAAATCTTAATGCTGACGATGAGCACTACAAGATTATCGTACGCGACAACAAAGACTCTCTATTATTGAAACAAATATGCCAGCATTATGCAGGCCTGGACTATATTAGTGGAGGTGTATACGGCTTTGGTCATAATAATAATATTGCGGTGGCGTATGTAAAGGAAAAATATAGACCCGCAGATGATGATTACATTTTGTTTTTGAATCCCGATATCATCATGAAGCATGATGATTTGCTGACATATATTAAATATGTCGAAAGTAAGCGTTATGCTTTTAGTACATTATGCCTGTTCCGAGATGAAGCGAAATCTTTACATGATTATTCCGTAAGAAAATTTCCTGTGCTTTCTGATTTTATTGTGTCATTTATGTTAGGGATTAATAAAACAAAAATTCCTAAAGAAAGTATCTATTCTGATACGGTTGTTGATTGGTGCGCAGGATCATTTATGCTGGTACGTTTTTCAGATTTTTGTGCGTGTAAATGGCTTCGATCAAGGTTACTTTATGTACTGTGAAGATATTGACCTGTGCTTGAGGCTTAGCCTGGCTGGTGTCAGACTTCATATGTTCCCGCTTTCATGCGATCCATTATGCTTCATCCAG</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY068BerkiGEM2007-Sequencing-AY0682007-08-16T19:26:23Z<p>Ayu: </p>
<hr />
<div>TTCGGCTAAGGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTACTAGAAGATCCCGCGGAATTAACCATGGTATATATAATAATCGTTTCCCACGGACATGAAGACTACATCAAAAAATTACTCGAAAATCTTAATGCTGACGATGAGCACTACAAGATTATCGTACGCGACAACAAAGACTCTCTATTATTGAAACAAATATGCCAGCATTATGCAGGCCTGGACTATATTAGTGGAGGTGTATACGGCTTTGGTCATAATAATAATATTGCGGTGGCGTATGTAAAGGAAAAATATAGACCCGCAGATGATGATTACATTTTGTTTTTGAATCCCGATATCATCATGAAGCATGATGATTTGCTGACATATATTAAATATGTCGAAAGTAAGCGTTATGCTTTTAGTACATTATGCCTGTTCCGAGATGAAGCGAAATCTTTACATGATTATTCCGTAAGAAAATTTCCTGTGCTTTCTGATTTTATTGTGTCATTTATGTTAGGGATTAATAAAACAAAAATTCCTAAAGAAAGTATCTATTCTGATACGGTTGTTGATTGGTGCGCAGGATCATTTATGCTGGTACGTTTTTCAGATTTTGTGCGTGTAAATGGCTTCGATCAAGGTTACTTTATGTACTGTGAAGATATTGACCTGTGCTTGAGGCTTAGCCTGGCTGGTGTCAGACTTCATTATGTTCCCGCTTTTCATGCGATACATTATGCTCATCATGACAATCGAAGTTTTTTTTCAAAAGCCTTCAGATGGCACTTAAAAAGTACTTTAGATATTTAGCCAGAAACGTATTTTATCCAATCGCACTTTGATCGATTTCATCAGTTTTC</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY067BerkiGEM2007-Sequencing-AY0672007-08-16T19:25:59Z<p>Ayu: </p>
<hr />
<div>ATGGGTGCTTTCGCTAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTACTAGAAGATCCCGCGGAATTAACCATGGTATATATAATAATCGTTTCCCACGGACATGAAGACTACATCAAAAAATTACTCGAAAATCTTAATGCTGACGATGAGCACTACAAGATTATCGTACGCGACAACAAAGACTCTCTATTATTGAAACAAATATGCCAGCATTATGCAGGCCTGGACTATATTAGTGGAGGTGTATACGGCTTTGGTCATAATAATAATATTGCGGTGGCGTATGTAAAGGAAAAATATAGACCCGCAGATGATGATTACATTTTGTTTTTGAATCCCGATATCATCATGAAGCATGATGATTTGCTGACATATATTAAATATGTCGAAAGTAAGCGTTATGCTTTTAGTACATTATGCCTGTTCCGAGATGAAGCGAAATCTTTACATGATTATTCCGTAAGAAAATTTCCTGTGCTTTCTGATTTTATTGTGTCATTTATGTTAGGGATTAATAAAACAAAAATTCCTAAAGAAAGTATCTATTCTGATACGGTTGTTGATTGGTGCGCAGGATCATTTATGCTGGTACGTTTTTCAGATTTTTGTGCGTGTAAATGGCTTTCGATCAAGGTTACTTTATGTACTGTGAAAGATATTGACCTGTGCTTTGAGGCTTAGCCTGGCTGGTGTCAGACTTTAATTATGTTCCCGCTTTTTCATGCGATACATTATGCTCATCCTGACAATCGGAGTTTTTTTTCAACAGCCTTCAGAAT</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY066BerkiGEM2007-Sequencing-AY0662007-08-16T19:25:47Z<p>Ayu: </p>
<hr />
<div>TCGACTAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTACTAGAAGATCCCGCGGAATTAACCATGGTATATATAATAATCGTTTCCCACGGACATGAAGACTACATCAAAAAATTACTCGAAAATCTTAATGCTGACGATGAGCACTACAAGATTATCGTACGCGACAACAAAGACTCTCTATTATTGAAACAAATATGCCAGCATTATGCAGGCCTGGACTATATTAGTGGAGGTGTATACGGCTTTGGTCATAATAATAATATTGCGGTGGCGTATGTAAAGGAAAAATATAGACCCGCAGATGATGATTACATTTTGTTTTTGAATCCCGATATCATCATGAAGCATGATGATTTGCTGACATATATTAAATATGTCGAAAGTAAGCGTTATGCTTTTAGTACATTATGCCTGTTCCGAGATGAAGCGAAATCTTTACATGATTATTCCGTAAGAAAATTTCCTGTGCTTTCTGATTTTATTGTGTCATTTATGTTAGGGATTAATAAAACAAAAATTCCTAAAGAAAGTATCTATTCTGATACGGTTGTTGATTGGTGCGCAGGATCATTTATGCTGGTACGTTTTTTCAGATTTTGTGCGTGTAAATGGCTTCGATCAAGGTTACTTTATGTAACTGTGAATATAATGG</div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurSequencingFilesTemplate:BerkiGEM2007 ArthurSequencingFiles2007-08-16T19:25:06Z<p>Ayu: /* Start 51 */</p>
<hr />
<div>'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 26|Skip to 26 Start]]'''<br />
<br><br />
'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 51|Skip to 51 Start]]'''<br />
{|<br />
|-<br />
|Sample||Date||Plasmid||Clone||Primer||Result||File Link<br />
|-<br />
|AY001||060407 ||pBca9145-Bca1145||#1||ca998||Probably good. Long, ambiguous long AAAAAAA.||[[BerkiGEM2007-Sequencing-AY001 | AY001]]<br />
|-<br />
|AY002||060407 ||pBca9145-Bca1145||#2||ca998||Good.||[[BerkiGEM2007-Sequencing-AY002 | AY002]]<br />
|-<br />
|AY003||061207||pBca9145-HPI/katG (I716253)||A1||ca998||super wrong. Seems like only half of HPI/katG, from the AY004.Sal.katG.HPI-Fx "mutate GAT>GAC (BglII)" til the end, was cloned.||[[BerkiGEM2007-Sequencing-AY003 | AY003]]<br />
|-<br />
|AY004||061207||pBca9145-HPI/katG (I716253)||A3||ca998||generally OK. There is one extra G at 584 in the goal plasmid in the calls file. There is low confidence, but I am not sure what to make of it. Possibly should send for recheck at this point; may be necessary to check the mutation point @1308, and the end portion as well. But based on the miniprep digest run yesterday, this guy has a high chance of being the right one. DECISION: sent as AY007 with G01001 for a reverse check.||[[BerkiGEM2007-Sequencing-AY004 | AY004]]<br />
|-<br />
|AY005||061207||pBca9145-HPI/katG (I716253)||A4||ca998||crazy :( there are big gaps||[[BerkiGEM2007-Sequencing-AY005 | AY005]]<br />
|-<br />
|AY006||061207||pBca9145-wbbL (I716000)||B1||ca998||also crazy||[[BerkiGEM2007-Sequencing-AY006 | AY006]]<br />
|-<br />
|AY007||061307||pBca9145-HPI/katG (I716???)||A3||G01001||Looks good actually, only notable thing is silent point mutation @ 1782 TCG > TCA still S. but the mutation point was just missed by sequencing. I don't think it's necessary to recheck; i have faith the primers worked right. well.. idk. major concern still is the possible addition mutation of a G||[[BerkiGEM2007-Sequencing-AY007 | AY007]]<br />
|-<br />
|AY008||061307||pBca9145-neuS (I716001)||C1||ca998||Forward. Looks great!||[[BerkiGEM2007-Sequencing-AY008 | AY008]]<br />
|-<br />
|AY009||061307||pBca9145-neuS (I716001)||C1||G01001||Reverse. Looks great!||[[BerkiGEM2007-Sequencing-AY009 | AY009]]<br />
|-<br />
|AY010||061407||I716002 (pBca9145-yfbE_promote)||D1||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C||[[BerkiGEM2007-Sequencing-AY010 | AY010]]<br />
|-<br />
|AY011||061407||I716002 (pBca9145-yfbE_promote)||D1||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY011 | AY011]]<br />
|-<br />
|AY012||061407||I716002 (pBca9145-yfbE_promote)||D4||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C. @640 addition of a C||[[BerkiGEM2007-Sequencing-AY012 | AY012]]<br />
|-<br />
|AY013||061407||I716002 (pBca9145-yfbE_promote)||D4||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY013 | AY013]]<br />
|-<br />
|AY014||061507||I716000 (pBca9145-wbbL)||E1||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T @ 812, but read quality is low here. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY014 | AY014]]<br />
|-<br />
|AY015||061507||I716000 (pBca9145-wbbL)||E2||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T at 801. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY015 | AY015]]<br />
|-<br />
|AY016||061807||I716000 (pBca9145-wbbL)||E1||G01001||good||[[BerkiGEM2007-Sequencing-AY016 | AY016]]<br />
|-<br />
|AY017||061807||I716000 (pBca9145-wbbL)||E2||G01001||good||[[BerkiGEM2007-Sequencing-AY017 | AY017]]<br />
|-<br />
|AY018||061807||I716253 (pBca9145-HPI/katG)||A3||ay007||good||[[BerkiGEM2007-Sequencing-AY018 | AY018]]<br />
|-<br />
|AY019||062107||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY019 | AY019]]<br />
|-<br />
|AY020||062107||I716006 (pBca9145-Bca9203 B5red)||G3||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY020 | AY020]]<br />
|-<br />
|AY021||062507||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||looks good||[[BerkiGEM2007-Sequencing-AY021 | AY021]]<br />
|-<br />
|AY022||062507||I716006 (pBca9145-Bca9203 B5red)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY022 | AY022]]<br />
|-<br />
|AY023||062507||I716005 (pBca9145-Bca9229 cytoB5)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY023 | AY023]]<br />
|-<br />
|AY024||062507||I716005 (pBca9145-Bca9229 cytoB5)||H4||ca998||looks good||[[BerkiGEM2007-Sequencing-AY024 | AY024]]<br />
|-<br />
|AY025||062807||I716002 (pBca9145-yfbE_promote)||IB||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY025 | AY025]]<br />
|}<br />
===Start 26===<br />
{|<br />
|-<br />
|AY026||062807||I716002 (pBca9145-yfbE_promote)||ID||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY026 | AY026]]<br />
|-<br />
|AY027||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J1||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY027 | AY027]]<br />
|-<br />
|AY028||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J2||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY028 | AY028]]<br />
|-<br />
|AY029||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J3||ca998||Ptet and wbbL were successfully cloned. neuS, unsure. Possibly neuS is gone since there could be a BamHI site right after wbbL in sequence file.||[[BerkiGEM2007-Sequencing-AY029 | AY029]]<br />
|-<br />
|AY030||071107||I716012 (101-008)||1||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY030 | AY030]]<br />
|-<br />
|AY031||071107||I716012 (101-008)||2||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY031 | AY031]]<br />
|-<br />
|AY032||071207||I716013 (pBca9145-yfbE-rbs-ATG)||1||ca998||V>A right after BglII site. Amino acid change is bad.||[[BerkiGEM2007-Sequencing-AY032 | AY032]]<br />
|-<br />
|AY033||071207||I716013 (pBca9145-yfbE-rbs-ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY033 | AY033]]<br />
|-<br />
|AY034||071207||I716014 (pBca9145-yfbE_solo)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY034 | AY034]]<br />
|-<br />
|AY035||071207||I716014 (pBca9145-yfbE_solo)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY035 | AY035]]<br />
|-<br />
|AY036||071207||I716014 (pBca9145-yfbE_solo)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY036 | AY036]]<br />
|-<br />
|AY037||071307||I716015 (RFP no ATG)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY037 | AY037]]<br />
|-<br />
|AY038||071307||I716015 (RFP no ATG)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY038 | AY038]]<br />
|-<br />
|AY039||071307||I716015 (RFP no ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY039 | AY039]]<br />
|-<br />
|AY040||071307||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet||[[BerkiGEM2007-Sequencing-AY040 | AY040]]<br />
|-<br />
|AY041||071707||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet AGAIN - but the sequencing is extremely mixed.||[[BerkiGEM2007-Sequencing-AY041 | AY041]]<br />
|-<br />
|AY042||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||ca998||T7 promoter, CytB5 and the first part of CytB5Red cloned successfully. 591 it is ambiguous if the base is right or not (CytB5Red) but data from Austin's I716011 sequence suggests that it is good.||[[BerkiGEM2007-Sequencing-AY042 | AY042]]<br />
|-<br />
|AY043||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||G01001||dblTerm and the rest of CytB5Red was cloned successfully.||[[BerkiGEM2007-Sequencing-AY043 | AY043]]<br />
|-<br />
|AY044||072307||I716008||R1||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY044 | AY044]]<br />
|-<br />
|AY045||072307||I716008||R2||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY045 | AY045]]<br />
|-<br />
|AY046||072307||I716008||R3||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY046 | AY046]]<br />
|-<br />
|AY047||072307||I716008||R4||ca998||Ptet intact. RBS appears garbled but it's because N's were not placed in the I716008 for the library. Need to map to check for neuS.||[[BerkiGEM2007-Sequencing-AY047 | AY047]]<br />
|-<br />
|AY048||072307||I716008||R5||ca998||wtf is this lol||[[BerkiGEM2007-Sequencing-AY048 | AY048]]<br />
|-<br />
|AY049||072307||I716008||R6||ca998||half of ptet is missing||[[BerkiGEM2007-Sequencing-AY049 | AY049]]<br />
|-<br />
|AY050||072307||I716008||R7||ca998||wtf is this||[[BerkiGEM2007-Sequencing-AY050 | AY050]]<br />
|}<br />
===Start 51===<br />
{|<br />
|-<br />
|AY051||072307||I716008||R8||ca998||half ptet missing||[[BerkiGEM2007-Sequencing-AY051 | AY051]]<br />
|-<br />
|AY052||072307||I716008||r9||ca998||wtf||[[BerkiGEM2007-Sequencing-AY052 | AY052]]<br />
|-<br />
|AY053||072607||I716012|| ||ca998||M.I.A.||[[BerkiGEM2007-Sequencing-AY053 | AY053]]<br />
|-<br />
|AY054||080607||I716026||V1||ca998||Great||[[BerkiGEM2007-Sequencing-AY054 | AY054]]<br />
|-<br />
|AY055||080607||I716026||V2||ca998||Great||[[BerkiGEM2007-Sequencing-AY055 | AY055]]<br />
|-<br />
|AY056||080607||I716026||V3||ca998||A -> G at position 136 in the sequence file||[[BerkiGEM2007-Sequencing-AY056 | AY056]]<br />
|-<br />
|AY057||080607||I716028||W1||ca998||T->C @ 269, G->T @ 539||[[BerkiGEM2007-Sequencing-AY057 | AY057]]<br />
|-<br />
|AY058||080607||I716028||W2||ca998||deletions and stuff, whoa||[[BerkiGEM2007-Sequencing-AY058 | AY058]]<br />
|-<br />
|AY059||080607||I716028||W3||ca998||Great||[[BerkiGEM2007-Sequencing-AY059 | AY059]]<br />
|-<br />
|AY060||080607||I716029||X1||ca998||Great||[[BerkiGEM2007-Sequencing-AY060 | AY060]]<br />
|-<br />
|AY061||080607||I716029||X2||ca998||A->G @ 531||[[BerkiGEM2007-Sequencing-AY061 | AY061]]<br />
|-<br />
|AY062||080607||I716029||X3||ca998||Great||[[BerkiGEM2007-Sequencing-AY062 | AY062]]<br />
|-<br />
|AY063||080707||I716024 VHb basic part||1||ca998||Great||[[BerkiGEM2007-Sequencing-AY063 | AY063]]<br />
|-<br />
|AY064||080707||I716024 VHb basic part||2||ca998||restriction sites in front are funny||[[BerkiGEM2007-Sequencing-AY064 | AY064]]<br />
|-<br />
|AY065||080707||I716024 VHb basic part||3||ca998||Great||[[BerkiGEM2007-Sequencing-AY065 | AY065]]<br />
|-<br />
|AY066||081407||I716024 VHb basic part||1||ca998||Great||[[BerkiGEM2007-Sequencing-AY066 | AY066]]<br />
|-<br />
|AY067||081407||I716024 VHb basic part||2||ca998||Great||[[BerkiGEM2007-Sequencing-AY067 | AY067]]<br />
|-<br />
|AY068||081407||I716024 VHb basic part||3||ca998||Great||[[BerkiGEM2007-Sequencing-AY068 | AY068]]<br />
|-<br />
|AY069||081407||I716024 VHb basic part||4||ca998||Great||[[BerkiGEM2007-Sequencing-AY069 | AY069]]<br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-15T23:27:30Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/15 so Zinc represses growth==<br />
* it represses growth! oh nooooo<br />
* will leave assay things going overnight<br />
* retrasnsformed I716034 because i am suspicious of the -80 pir116 i made earlier<br />
==8/14 hurrah==<br />
* I716034 "knockin'" is xformed into pir116 and plated. hopefully it works.<br />
* so this pzhuC thing works with 20x the zinc used before (i think you need 20 uL of 1M ZnCl2 per each 1 mL)<br />
* growth curve assay says... the things with zinc stopped growth at 0.06 OD. what?????<br />
* incubating various 5 mL tubies of varying zinc added.<br />
==8/13 status report==<br />
* pzhuC: 8 different clones stuck with zinc to see if any turn off zincyness<br />
# also 30.la and 30.2b put into varying concentrations Zn2+<br />
* wbbl/neus into genome: incubated some clones and will xform tmrw. made competant pir116s today (too lightly colored solution?)<br />
''todo'': catelogue my boxes. make presentation draft draft. make t-shirts/other clothing<br />
==8/7 good productivity==<br />
* so what have I done recently?<br />
# I716026 pznuC (Zn2+ repressed promoter) and I716030 composite with RFP. The RFP is incubating right now<br />
# I716028 pmgrB (Mg2+ repressed promoter) and I716031 w/RFP this is where I try to cut off the rbs to just get a basic promoter part.<br />
# I716028 pmgrB and I716032 also incubating. This is where I try to inclube the RBS. Stops before the ORF in the MG1655 genome.<br />
# wbbL neuS - assay worked great, so my clone of I716023 is good (however it's Bbriock v1.0). Currrently working on integrating it into the genome. Just transformed into DH10B today, and plated.<br />
''Other things:'' two bottles of LB went bad (???). somebody jacked my red pipetter. we need more lb/amp plates ._.<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-14T23:36:33Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/14 hurrah==<br />
* I716034 "knockin'" is xformed into pir116 and plated. hopefully it works.<br />
* so this pzhuC thing works with 20x the zinc used before (i think you need 20 uL of 1M ZnCl2 per each 1 mL)<br />
* growth curve assay says... the things with zinc stopped growth at 0.06 OD. what?????<br />
* incubating various 5 mL tubies of varying zinc added.<br />
==8/13 status report==<br />
* pzhuC: 8 different clones stuck with zinc to see if any turn off zincyness<br />
# also 30.la and 30.2b put into varying concentrations Zn2+<br />
* wbbl/neus into genome: incubated some clones and will xform tmrw. made competant pir116s today (too lightly colored solution?)<br />
''todo'': catelogue my boxes. make presentation draft draft. make t-shirts/other clothing<br />
==8/7 good productivity==<br />
* so what have I done recently?<br />
# I716026 pznuC (Zn2+ repressed promoter) and I716030 composite with RFP. The RFP is incubating right now<br />
# I716028 pmgrB (Mg2+ repressed promoter) and I716031 w/RFP this is where I try to cut off the rbs to just get a basic promoter part.<br />
# I716028 pmgrB and I716032 also incubating. This is where I try to inclube the RBS. Stops before the ORF in the MG1655 genome.<br />
# wbbL neuS - assay worked great, so my clone of I716023 is good (however it's Bbriock v1.0). Currrently working on integrating it into the genome. Just transformed into DH10B today, and plated.<br />
''Other things:'' two bottles of LB went bad (???). somebody jacked my red pipetter. we need more lb/amp plates ._.<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-14T22:45:39Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/14 hurrah==<br />
* I716034 "knockin'" is xformed into pir116 and plated. hopefully it works.<br />
* so this pzhuC thing works with 20x the zinc used before (i think you need 20 uL of 1M ZnCl2 per each 1 mL)<br />
* growth curve assay says...<br />
==8/13 status report==<br />
* pzhuC: 8 different clones stuck with zinc to see if any turn off zincyness<br />
# also 30.la and 30.2b put into varying concentrations Zn2+<br />
* wbbl/neus into genome: incubated some clones and will xform tmrw. made competant pir116s today (too lightly colored solution?)<br />
''todo'': catelogue my boxes. make presentation draft draft. make t-shirts/other clothing<br />
==8/7 good productivity==<br />
* so what have I done recently?<br />
# I716026 pznuC (Zn2+ repressed promoter) and I716030 composite with RFP. The RFP is incubating right now<br />
# I716028 pmgrB (Mg2+ repressed promoter) and I716031 w/RFP this is where I try to cut off the rbs to just get a basic promoter part.<br />
# I716028 pmgrB and I716032 also incubating. This is where I try to inclube the RBS. Stops before the ORF in the MG1655 genome.<br />
# wbbL neuS - assay worked great, so my clone of I716023 is good (however it's Bbriock v1.0). Currrently working on integrating it into the genome. Just transformed into DH10B today, and plated.<br />
''Other things:'' two bottles of LB went bad (???). somebody jacked my red pipetter. we need more lb/amp plates ._.<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-13T22:02:47Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/13 status report==<br />
* pzhuC: 8 different clones stuck with zinc to see if any turn off zincyness<br />
# also 30.la and 30.2b put into varying concentrations Zn2+<br />
* wbbl/neus into genome: incubated some clones and will xform tmrw. made competant pir116s today (too lightly colored solution?)<br />
''todo'': catelogue my boxes. make presentation draft draft. make t-shirts/other clothing<br />
==8/7 good productivity==<br />
* so what have I done recently?<br />
# I716026 pznuC (Zn2+ repressed promoter) and I716030 composite with RFP. The RFP is incubating right now<br />
# I716028 pmgrB (Mg2+ repressed promoter) and I716031 w/RFP this is where I try to cut off the rbs to just get a basic promoter part.<br />
# I716028 pmgrB and I716032 also incubating. This is where I try to inclube the RBS. Stops before the ORF in the MG1655 genome.<br />
# wbbL neuS - assay worked great, so my clone of I716023 is good (however it's Bbriock v1.0). Currrently working on integrating it into the genome. Just transformed into DH10B today, and plated.<br />
''Other things:'' two bottles of LB went bad (???). somebody jacked my red pipetter. we need more lb/amp plates ._.<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY065BerkiGEM2007-Sequencing-AY0652007-08-13T18:56:10Z<p>Ayu: </p>
<hr />
<div>ACGTTAGCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTATGTTAGACCAGCAAACCATTAACATCATCAAAGCCA<br />
CTGTTCCTGTATTGAAGGAGCATGGCGTTACCATTACCACGACTTTTTATAAAAACTTGTTTGCCAAACACCCTGAAGTA<br />
CGTCCTTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGATGACGGTATTGGCGGCAGCGCA<br />
AAACATTGAAAATTTGCCAGCTATTTTGCCTGCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAG<br />
CGCATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGGCGATGCCGCAACCGATGACATTTTG<br />
GACGCGTGGGGCAAGGCTTATGGCGTGATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGA<br />
ATAAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAT<br />
CAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG<br />
CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCCTGACGAGCATCACAAAA<br />
ATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAAGCTCCCTCGT<br />
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATA<br />
GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCCGTCAGCCC<br />
GACGCTGCGCCTATCGGTAACTATCGTCTGAGTCAACCCGGTAGAACACGACTTATCGCCACTGCAGCAGCACTGTACAG<br />
ATAGCAGAGCGAAGTATGTAGCGGTGCTACGAGTCTGATTGGTGACTTAACTACGGCTACCTAGAAGAATCGGTATCGAT<br />
CTGGACCTTAGCTGAGAGTCCAGTAACCGTACCGAAAAAGAGAGTCG</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY064BerkiGEM2007-Sequencing-AY0642007-08-13T18:56:02Z<p>Ayu: </p>
<hr />
<div>AGCGTTAGCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTATGTTAGACCAGCAAACCATTAACATCATCAAAGCCA<br />
CTGTTCCTGTATTGAAGGAGCATGGCGTTACCATTACCACGACTTTTTATAAAAACTTGTTTGCCAAACACCCTGAAGTA<br />
CGTCCTTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGATGACGGTATTGGCGGCAGCGCA<br />
AAACATTGAAAATTTGCCAGCTATTTTGCCTGCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAG<br />
CGCATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGGCGATGCCGCAACCGATGACATTTTG<br />
GACGCGTGGGGCAAGGCTTATGGCGTGATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGA<br />
ATAAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAT<br />
CAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG<br />
CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAA<br />
TCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAAGCTCCCTCGTG<br />
CGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGCGCTTTCTCATAGC<br />
TCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGA<br />
CCGCTGCGCATAATCAGTACTATCGTCTGAGTCCAACCAGTTAAGACCCGACTATCGGCCACTGCAGCAGCCACTGTAAC<br />
TGATAGCAGAGCGAGTATGTAGCGTGCTACGAGTCTGAATGTGCCTACTACGCTAACTAAAGACGGAATTCATCTGGCCT<br />
AGCGCTGACAGTTACCTCGGAAAAATGTTCGTAAGCCTCTGGA</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY063BerkiGEM2007-Sequencing-AY0632007-08-13T18:55:54Z<p>Ayu: </p>
<hr />
<div>TGATAGCTTTCGCTAAGGATGATTTCTGGAATTCATGAGATCTATGTTAGACCAGCAAACCATTAACATCATCAAAGCCA<br />
CTGTTCCTGTATTGAAGGAGCATGGCGTTACCATTACCACGACTTTTTATAAAAACTTGTTTGCCAAACACCCTGAAGTA<br />
CGTCCTTTGTTTGATATGGGTCGCCAAGAATCTTTGGAGCAGCCTAAGGCTTTGGCGATGACGGTATTGGCGGCAGCGCA<br />
AAACATTGAAAATTTGCCAGCTATTTTGCCTGCGGTCAAAAAAATTGCAGTCAAACATTGTCAAGCAGGCGTGGCAGCAG<br />
CGCATTATCCGATTGTCGGTCAAGAATTGTTGGGTGCGATTAAAGAAGTATTGGGCGATGCCGCAACCGATGACATTTTG<br />
GACGCGTGGGGCAAGGCTTATGGCGTGATTGCAGATGTGTTTATTCAAGTGGAAGCAGATTTGTACGCTCAAGCGGTTGA<br />
ATAAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTAT<br />
CAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAG<br />
CAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAA<br />
TCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGC<br />
GCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGC<br />
TCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCGAC<br />
CGCTGCGCTTATCAGTACTATCGTCTTGAGTCAACCAGTAGGACCCGACTTATCGCACTGCAGCAGCCACTGTACAGATA<br />
GCAGAGCGAGTATGTAAGCCGTGCTACAGAGTCCTTGATTGTGACCTTACTACGGCTTACACTAGAGACGATTGGATCTC<br />
GCTGCTGACAGTTACTCGAAGGAAGGTAGCTCTGAATTCG</div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurSequencingFilesTemplate:BerkiGEM2007 ArthurSequencingFiles2007-08-13T18:55:40Z<p>Ayu: </p>
<hr />
<div>'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 26|Skip to 26 Start]]'''<br />
<br><br />
'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 51|Skip to 51 Start]]'''<br />
{|<br />
|-<br />
|Sample||Date||Plasmid||Clone||Primer||Result||File Link<br />
|-<br />
|AY001||060407 ||pBca9145-Bca1145||#1||ca998||Probably good. Long, ambiguous long AAAAAAA.||[[BerkiGEM2007-Sequencing-AY001 | AY001]]<br />
|-<br />
|AY002||060407 ||pBca9145-Bca1145||#2||ca998||Good.||[[BerkiGEM2007-Sequencing-AY002 | AY002]]<br />
|-<br />
|AY003||061207||pBca9145-HPI/katG (I716253)||A1||ca998||super wrong. Seems like only half of HPI/katG, from the AY004.Sal.katG.HPI-Fx "mutate GAT>GAC (BglII)" til the end, was cloned.||[[BerkiGEM2007-Sequencing-AY003 | AY003]]<br />
|-<br />
|AY004||061207||pBca9145-HPI/katG (I716253)||A3||ca998||generally OK. There is one extra G at 584 in the goal plasmid in the calls file. There is low confidence, but I am not sure what to make of it. Possibly should send for recheck at this point; may be necessary to check the mutation point @1308, and the end portion as well. But based on the miniprep digest run yesterday, this guy has a high chance of being the right one. DECISION: sent as AY007 with G01001 for a reverse check.||[[BerkiGEM2007-Sequencing-AY004 | AY004]]<br />
|-<br />
|AY005||061207||pBca9145-HPI/katG (I716253)||A4||ca998||crazy :( there are big gaps||[[BerkiGEM2007-Sequencing-AY005 | AY005]]<br />
|-<br />
|AY006||061207||pBca9145-wbbL (I716000)||B1||ca998||also crazy||[[BerkiGEM2007-Sequencing-AY006 | AY006]]<br />
|-<br />
|AY007||061307||pBca9145-HPI/katG (I716???)||A3||G01001||Looks good actually, only notable thing is silent point mutation @ 1782 TCG > TCA still S. but the mutation point was just missed by sequencing. I don't think it's necessary to recheck; i have faith the primers worked right. well.. idk. major concern still is the possible addition mutation of a G||[[BerkiGEM2007-Sequencing-AY007 | AY007]]<br />
|-<br />
|AY008||061307||pBca9145-neuS (I716001)||C1||ca998||Forward. Looks great!||[[BerkiGEM2007-Sequencing-AY008 | AY008]]<br />
|-<br />
|AY009||061307||pBca9145-neuS (I716001)||C1||G01001||Reverse. Looks great!||[[BerkiGEM2007-Sequencing-AY009 | AY009]]<br />
|-<br />
|AY010||061407||I716002 (pBca9145-yfbE_promote)||D1||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C||[[BerkiGEM2007-Sequencing-AY010 | AY010]]<br />
|-<br />
|AY011||061407||I716002 (pBca9145-yfbE_promote)||D1||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY011 | AY011]]<br />
|-<br />
|AY012||061407||I716002 (pBca9145-yfbE_promote)||D4||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C. @640 addition of a C||[[BerkiGEM2007-Sequencing-AY012 | AY012]]<br />
|-<br />
|AY013||061407||I716002 (pBca9145-yfbE_promote)||D4||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY013 | AY013]]<br />
|-<br />
|AY014||061507||I716000 (pBca9145-wbbL)||E1||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T @ 812, but read quality is low here. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY014 | AY014]]<br />
|-<br />
|AY015||061507||I716000 (pBca9145-wbbL)||E2||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T at 801. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY015 | AY015]]<br />
|-<br />
|AY016||061807||I716000 (pBca9145-wbbL)||E1||G01001||good||[[BerkiGEM2007-Sequencing-AY016 | AY016]]<br />
|-<br />
|AY017||061807||I716000 (pBca9145-wbbL)||E2||G01001||good||[[BerkiGEM2007-Sequencing-AY017 | AY017]]<br />
|-<br />
|AY018||061807||I716253 (pBca9145-HPI/katG)||A3||ay007||good||[[BerkiGEM2007-Sequencing-AY018 | AY018]]<br />
|-<br />
|AY019||062107||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY019 | AY019]]<br />
|-<br />
|AY020||062107||I716006 (pBca9145-Bca9203 B5red)||G3||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY020 | AY020]]<br />
|-<br />
|AY021||062507||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||looks good||[[BerkiGEM2007-Sequencing-AY021 | AY021]]<br />
|-<br />
|AY022||062507||I716006 (pBca9145-Bca9203 B5red)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY022 | AY022]]<br />
|-<br />
|AY023||062507||I716005 (pBca9145-Bca9229 cytoB5)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY023 | AY023]]<br />
|-<br />
|AY024||062507||I716005 (pBca9145-Bca9229 cytoB5)||H4||ca998||looks good||[[BerkiGEM2007-Sequencing-AY024 | AY024]]<br />
|-<br />
|AY025||062807||I716002 (pBca9145-yfbE_promote)||IB||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY025 | AY025]]<br />
|}<br />
===Start 26===<br />
{|<br />
|-<br />
|AY026||062807||I716002 (pBca9145-yfbE_promote)||ID||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY026 | AY026]]<br />
|-<br />
|AY027||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J1||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY027 | AY027]]<br />
|-<br />
|AY028||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J2||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY028 | AY028]]<br />
|-<br />
|AY029||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J3||ca998||Ptet and wbbL were successfully cloned. neuS, unsure. Possibly neuS is gone since there could be a BamHI site right after wbbL in sequence file.||[[BerkiGEM2007-Sequencing-AY029 | AY029]]<br />
|-<br />
|AY030||071107||I716012 (101-008)||1||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY030 | AY030]]<br />
|-<br />
|AY031||071107||I716012 (101-008)||2||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY031 | AY031]]<br />
|-<br />
|AY032||071207||I716013 (pBca9145-yfbE-rbs-ATG)||1||ca998||V>A right after BglII site. Amino acid change is bad.||[[BerkiGEM2007-Sequencing-AY032 | AY032]]<br />
|-<br />
|AY033||071207||I716013 (pBca9145-yfbE-rbs-ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY033 | AY033]]<br />
|-<br />
|AY034||071207||I716014 (pBca9145-yfbE_solo)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY034 | AY034]]<br />
|-<br />
|AY035||071207||I716014 (pBca9145-yfbE_solo)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY035 | AY035]]<br />
|-<br />
|AY036||071207||I716014 (pBca9145-yfbE_solo)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY036 | AY036]]<br />
|-<br />
|AY037||071307||I716015 (RFP no ATG)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY037 | AY037]]<br />
|-<br />
|AY038||071307||I716015 (RFP no ATG)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY038 | AY038]]<br />
|-<br />
|AY039||071307||I716015 (RFP no ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY039 | AY039]]<br />
|-<br />
|AY040||071307||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet||[[BerkiGEM2007-Sequencing-AY040 | AY040]]<br />
|-<br />
|AY041||071707||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet AGAIN - but the sequencing is extremely mixed.||[[BerkiGEM2007-Sequencing-AY041 | AY041]]<br />
|-<br />
|AY042||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||ca998||T7 promoter, CytB5 and the first part of CytB5Red cloned successfully. 591 it is ambiguous if the base is right or not (CytB5Red) but data from Austin's I716011 sequence suggests that it is good.||[[BerkiGEM2007-Sequencing-AY042 | AY042]]<br />
|-<br />
|AY043||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||G01001||dblTerm and the rest of CytB5Red was cloned successfully.||[[BerkiGEM2007-Sequencing-AY043 | AY043]]<br />
|-<br />
|AY044||072307||I716008||R1||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY044 | AY044]]<br />
|-<br />
|AY045||072307||I716008||R2||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY045 | AY045]]<br />
|-<br />
|AY046||072307||I716008||R3||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY046 | AY046]]<br />
|-<br />
|AY047||072307||I716008||R4||ca998||Ptet intact. RBS appears garbled but it's because N's were not placed in the I716008 for the library. Need to map to check for neuS.||[[BerkiGEM2007-Sequencing-AY047 | AY047]]<br />
|-<br />
|AY048||072307||I716008||R5||ca998||wtf is this lol||[[BerkiGEM2007-Sequencing-AY048 | AY048]]<br />
|-<br />
|AY049||072307||I716008||R6||ca998||half of ptet is missing||[[BerkiGEM2007-Sequencing-AY049 | AY049]]<br />
|-<br />
|AY050||072307||I716008||R7||ca998||wtf is this||[[BerkiGEM2007-Sequencing-AY050 | AY050]]<br />
|}<br />
===Start 51===<br />
{|<br />
|-<br />
|AY051||072307||I716008||R8||ca998||half ptet missing||[[BerkiGEM2007-Sequencing-AY051 | AY051]]<br />
|-<br />
|AY052||072307||I716008||r9||ca998||wtf||[[BerkiGEM2007-Sequencing-AY052 | AY052]]<br />
|-<br />
|AY053||072607||I716012|| ||ca998||M.I.A.||[[BerkiGEM2007-Sequencing-AY053 | AY053]]<br />
|-<br />
|AY054||080607||I716026||V1||ca998||Great||[[BerkiGEM2007-Sequencing-AY054 | AY054]]<br />
|-<br />
|AY055||080607||I716026||V2||ca998||Great||[[BerkiGEM2007-Sequencing-AY055 | AY055]]<br />
|-<br />
|AY056||080607||I716026||V3||ca998||A -> G at position 136 in the sequence file||[[BerkiGEM2007-Sequencing-AY056 | AY056]]<br />
|-<br />
|AY057||080607||I716028||W1||ca998||T->C @ 269, G->T @ 539||[[BerkiGEM2007-Sequencing-AY057 | AY057]]<br />
|-<br />
|AY058||080607||I716028||W2||ca998||deletions and stuff, whoa||[[BerkiGEM2007-Sequencing-AY058 | AY058]]<br />
|-<br />
|AY059||080607||I716028||W3||ca998||Great||[[BerkiGEM2007-Sequencing-AY059 | AY059]]<br />
|-<br />
|AY060||080607||I716029||X1||ca998||Great||[[BerkiGEM2007-Sequencing-AY060 | AY060]]<br />
|-<br />
|AY061||080607||I716029||X2||ca998||A->G @ 531||[[BerkiGEM2007-Sequencing-AY061 | AY061]]<br />
|-<br />
|AY062||080607||I716029||X3||ca998||Great||[[BerkiGEM2007-Sequencing-AY062 | AY062]]<br />
|-<br />
|AY063||080707||I716024 VHb basic part||1||ca998||Great||[[BerkiGEM2007-Sequencing-AY063 | AY063]]<br />
|-<br />
|AY064||080707||I716024 VHb basic part||2||ca998||restriction sites in front are funny||[[BerkiGEM2007-Sequencing-AY064 | AY064]]<br />
|-<br />
|AY065||080707||I716024 VHb basic part||3||ca998||Great||[[BerkiGEM2007-Sequencing-AY065 | AY065]]<br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/Berkeley_UCBerkeley UC2007-08-13T18:47:03Z<p>Ayu: </p>
<hr />
<div>[[Image:Berkeley_BactobloodHeader.jpg]]<br />
<br />
'''The global demand and importance for<br />
cheap, available, and disease free blood substitutes<br />
is undisputed. There are currently no red blood cell<br />
substitutes approved for clinical use in the US or<br />
the UK, and whole blood is almost always in short<br />
supply. Underdeveloped countries that need blood<br />
the most simply don’t have the infrastructure to<br />
support donation and storage, in addition a sizeable<br />
fraction of the population are disease carriers.<br><br><br />
We have developed a red blood cell substitute by modifying the E. coli chassis to make it safer to inject into the human bloodstream, and by adding components for oxygen delivery. A modified lipopolysaccharide significantly (1000-10000x) reduces sepsis activity. Other essential components include heme, hemoglobin, and cytochrome b5 and b5 reductase. Additional chaperone proteins such as sodC and HPI-katG were added to prolong the half-life of the E. coli in the bloodstream.<br>''' <br />
<br />
<br />
----<br />
<br />
<br />
{| cellspacing="2px" cellpadding="5" border="2" style="padding: 0px; width: 780px; color: navyblue; background-color: lightblue;"<br />
|-valign="top"<br />
|width=189.25px style="padding: 10px; background-color: lightblue; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Members</h3></center><br />
<br />
----<br />
<br />
<br />
'''Advisors'''<br><br />
[[John Dueber]]<br><br />
[http://www.openwetware.org/wiki/User:JCAnderson Christopher Anderson]<br><br />
[http://genomics.lbl.gov/ Adam Arkin]<br><br />
[https://keaslinglab.lbl.gov/wiki/index.php/Main_Page Jay Keasling]<br><br />
<br />
'''Teaching Assistants''' <br><br />
[[Farnaz Nowroozi]]<br><br />
[[Amin Hajimorad]]<br><br />
[[Rickey Bonds]]<br><br />
<br />
'''Undergraduate Researchers''' <br><br />
[[Arthur Yu]]<br><br />
[[Austin Day]]<br><br />
[[David Tulga]]<br><br />
[[Kristin Doan]]<br><br />
[[Samantha Liang]]<br><br />
[[Vaibhavi Umesh]]<br><br />
[[Kristin Fuller]]<br><br />
<br />
'''High School Students''' <br><br />
[[Vincent Parker]]<br><br />
[[Nhu Nguyen]]<br><br />
[[Hannah Cole]]<br><br />
<br />
|width=189.25px style="padding:10px; background-color: #ffffaa; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Resources</h3></center><br />
<br />
----<br />
<br />
<br />
[http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9TxjeURaNm1Vw Oligo List Spreadsheet]<br><br />
[http://spreadsheets.google.com/ccc?key=pUQEpr4ZqU9TerIU8gSvKbQ CloneSaver Spreadsheet]<br><br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=Berkeley_UC Our BioBrick Parts]<br><br />
[[BerkiGEM2007_AllConstructionFiles | All construction files]]<br><br />
[[BerkiGEM2007_AllSequencingFiles | All sequencing files]]<br><br />
<br />
''If you need an invitation to the spreadsheets, ask Sam.''<br />
<br />
<br />
'''Tools and Guides'''<br><br />
<br />
[http://www.openwetware.org/wiki/Arking:JCAOligoTutorialHome Biobricks and Cloning Tutorials]<br><br />
[http://pir.georgetown.edu/pirwww/search/pairwise.shtml Pairwise Alignment Online]<br><br />
[http://align.genome.jp/ Multiple Sequence Alignment]<br><br />
[http://en.wikipedia.org/wiki/Help:Wikitext_examples Wiki Formatting Guide]<br><br />
<br />
<br />
'''Useful Links'''<br />
<br />
[http://openwetware.org/wiki/IGEM:UC_Berkeley/2006 UC Berkeley iGEM 2006 OpenWetWare] <br><br />
[http://parts2.mit.edu/wiki/index.php/University_of_California_Berkeley_2006 UC Berkeley iGEM 2006 wiki] <br><br />
iGEM wikis: [http://parts2.mit.edu/wiki/index.php/Main_Page 2006], [[Main_Page|2007]]<br><br />
[http://partsregistry.org/Main_Page Registry of Standard Biological Parts] <br><br />
Biobricks Parts Lists: [http://parts2.mit.edu/r/parts/partsdb/pgroup.cgi?pgroup=iGEM&group=iGEM_Berkeley 2005], [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2006&group=Berkeley 2006], [http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=Berkeley_UC 2007]<br><br />
[http://openwetware.org/wiki/Arking:JCAOligoTutorialHome Tutorials]<br />
<br />
<br />
|width=300.25px style="padding: 10px; background-color: lightblue; border: 2px solid #993300;" |<br />
<br />
<center><h3>Team Notebooks</h3></center><br />
<br />
----<br />
<br />
<br />
[[John Dueber Notebook]]<br><br />
[[Christopher Anderson Notebook]]<br><br />
[[Farnaz Nowroozi Notebook]]<br><br />
[[Amin Hajimorad Notebook]]<br><br />
[[Rickey Bonds Notebook]]<br><br />
<br />
<br />
''Keep your wiki notebooks, sequencing/construction logs, and the registry updated!''<br />
<br />
<br />
[[Arthur Yu Notebook | Arthur Yu's 1337 Notebook]]<br><br />
[[Austin Day Notebook]]<br><br />
[[David Tulga Notebook | David Tulga's Notebook]]<br><br />
[[Kristin Doan Notebook]]<br><br />
[[Samantha Liang Notebook | Samantha's Notebook (June - July 19, 2007]]<br><br />
[[Samantha Liang Notebook2 | Samantha's Notebook (July 20, 2007 - present)]]<br><br />
[[Vaibhavi Umesh Notebook]]<br><br />
[[Kristin Fuller Notebook]]<br><br />
<br />
<br />
[[Vincent Parker Notebook]]<br><br />
[[Nhu Nguyen Notebook]]<br><br />
[[Hannah Cole Notebook]]<br><br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-07T22:23:29Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/7 good productivity==<br />
* so what have I done recently?<br />
# I716026 pznuC (Zn2+ repressed promoter) and I716030 composite with RFP. The RFP is incubating right now<br />
# I716028 pmgrB (Mg2+ repressed promoter) and I716031 w/RFP this is where I try to cut off the rbs to just get a basic promoter part.<br />
# I716028 pmgrB and I716032 also incubating. This is where I try to inclube the RBS. Stops before the ORF in the MG1655 genome.<br />
# wbbL neuS - assay worked great, so my clone of I716023 is good (however it's Bbriock v1.0). Currrently working on integrating it into the genome. Just transformed into DH10B today, and plated.<br />
''Other things:'' two bottles of LB went bad (???). somebody jacked my red pipetter. we need more lb/amp plates ._.<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY062BerkiGEM2007-Sequencing-AY0622007-08-07T18:11:30Z<p>Ayu: </p>
<hr />
<div>GCTTTAGCTTTCGCTAAGGATGATTTCTGGATTCATGAGATCTTGAGAGTAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGTCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACATAAGGTAGGTGAAACGGAGATTGGAGTGAAAAAGTTTCGGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTTCTCCTGTTCCGACCCTGCCGCTTTACGATACCTGTCCGCCTTTTCTCCCTTTCAGGAGCGTGGCGCTTTCCTCCATAGCTCCACGCTTGAAGTATCTCCAGTTTCGTGTAGTTCGTTCCGCTCGAGCTGGGTCCGGTGTGACACGATCTCT</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY061BerkiGEM2007-Sequencing-AY0612007-08-07T18:11:22Z<p>Ayu: </p>
<hr />
<div>CGGTTGCCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTTGAGAGTAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGTCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACGTAAGGTAGGTGAAACGGAGATTGGAGTGAAAAAGTTTCGGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACGGGATACCTGTCGCCTTTCTCCTTCGGGGAGGCGTTGGCGCTTTCTCATAGCTCACGCTGTAGTTCTCAGTCGGTAGGTCGTTCGCCTCAAGCTGGGCTGTGTGCACGACCCTCCCGTCAGTCGACCGCTGGCCTATCGTAACATCGCTGGATCCAACGCTAGACGACTATCGCCAGTGCACAGCATGTACGAATACGACGCACGATGTATAGCGAGCA</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY060BerkiGEM2007-Sequencing-AY0602007-08-07T18:11:15Z<p>Ayu: </p>
<hr />
<div>CCATTGTCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTTGAGAGTAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGTCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACATAAGGTAGGTGAAACGGAGATTGGAGTGAAAAAGTTTCGGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCACGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGGTCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCGCCTTTCTTCCTTTCGGGAAGCGTGCGCTTCTCATAGCTCACGCTGTAGTATCTCAGGTCGTGGTAAGTCGTTCGCTCAAGCTTGGCCTGTGTGCACGACCTCCCGTTCAGCCGACGCTGGCTCTAATCGGTACTATCGTCTTGAGTTCACTGTAGAACCGACTATCGCCCATGGCCACCATGTACGATACGAGTCAGGATTGCTGCGCGGTCTATTCA</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY059BerkiGEM2007-Sequencing-AY0592007-08-07T18:10:58Z<p>Ayu: </p>
<hr />
<div>ATCATTAGCCTTTCGCTAAGGATGATTTCTGGATTCATGAGATCTTGAGAGTAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGTCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACATAAGGTAGGTGAAACGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTTCGGGAAGCGTGCGCTTTCTCATAGCTCACGCTGTAGTATCTCAGTCGTGTAGTTCGTCGCTCAAGCTGGGCTGTGTGCACGATCCTCGGTTCAGTCGGACGGCTGCGCTATCGTAACTATCGTCCTGGATCAATCGGTAGACCGACTATGCCATGACGACGTCCATTGGTACGATCGACAGGATTGTAGCGGTCTACAAGAGTTCTTGA</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY058BerkiGEM2007-Sequencing-AY0582007-08-07T18:10:50Z<p>Ayu: </p>
<hr />
<div>AGGTTAGCCTTTCGCTAGGATGATTTCTGGAATTCATGAGATCTTGAGAGAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGTCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACATAAGGTAGGTGAAACGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCTCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTTCCGCCTTTCTCCTTCGGGAGCGTGCGCTTTTCTCATAGCTCACGCTGTAGTATCTTCAGTTCGTGTAGTCGTTCGCTCAAGCTGGGCTGTGTGCACGAACCCCCCGGTTCAGCCCGACGCTGCGCTAATCGTACCTATCGGTCCTGGAGTCCGCAGTAGAACCGACTATCGCCACTGAGCAGCCATGGTAACGATCAGCACGATGTAGGCGGTCTACAGGTCTTGA</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY057BerkiGEM2007-Sequencing-AY0572007-08-07T18:10:43Z<p>Ayu: </p>
<hr />
<div>CCATTAGCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTTGAGAGTAAGAACCTGTCGGAATATCAAACAGACAGGTTCTTTATTTAGCATGAGAAAAATAAAGTTGAAGGTGGCGTTATATTAAACGCGCTTGCTATAAGAGTATTTTACTCAGGAGTGAGAATCTGGTTATTTATTGCCCTTAACCATTATCGACCACGATATTGCTTTTGCGTAACAGCGGGCAATCTGTTATCCCCAAAAAACCACTTTTAGTGTGCAAGTATTGTACCGTGCTGGTGCCTCTGGCAGCCAGATAGGTACATTGCAAACCTAATCCTGCGGCATTCTCTTTGCTTCCAATCAAAACGCCATATCCGCTGAGTAATAATCCTATCCATACCAGTGCTATCAGCATAACTGTGCGAATGATGAATCGCATTACAACCTCTTCTCTTTTTATGTTCGCTTAATCGTAGCGGCAATATGCGCTGAAGCAAGCGACTCATTCCGAAAAAGCACGAATATCGACATAGTTAGGCGCTGTTTAACTAACGCATGCTAGTTTAATGACATAAGGTATGTGAAACGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAAGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCCAGAG</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY056BerkiGEM2007-Sequencing-AY0562007-08-07T18:10:35Z<p>Ayu: </p>
<hr />
<div>TGTTGCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTGGCGGATAATGCTGCGAAAAGAAGCGTTTTTTTATGTAACATAATGCGACCAATAATCGTAATGAATATGAGAAGTGTGATATTATAACATTTCATGACTACTGCAAGACTAAAATTAACGTGACAAGTCTGGTTTCCCTGGAAAATGTCTCGGTTTCTTTTGGCCAACGCCGCGTCCTCTCTGATGTGTCGCTGGAACTTAAACCTGGAAAAATTTTGAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCCTAACTACGCTACACTAGAGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTACTTTCGAAAAAGAGTTGGTAGCTCTGATCGCAAACAACAACGCTGTAGCGGTGGTTTTTTTGCTGCAGCAGCGATACGCGCAGAAAAAATGATCTCAGAGATCTTTGGATCTCTCTACGCTCTGACGCTCAATTGACGAAACCTCCGTTAGGATTTGCATGAATACGAAGACTTACTGATCTCACTCAACTGAGCTCAATCACTGAGAT</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY055BerkiGEM2007-Sequencing-AY0552007-08-07T18:10:12Z<p>Ayu: </p>
<hr />
<div>TCTTTTGCTTTTCGCTAGGATGATTTCTGGATTCATGAGATCTGGCGGATAATGCTGCGAAAAGAAGCGTTTTTTTATGTAACATAATGCGACCAATAATCGTAATGAATATGAGAAGTGTGATATTATAACATTTCATGACTACTGCAAGACTAAAATTAACATGACAAGTCTGGTTTCCCTGGAAAATGTCTCGGTTTCTTTTGGCCAACGCCGCGTCCTCTCTGATGTGTCGCTGGAACTTAAACCTGGAAAAATTTTGAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAAGCGGTGCTAC</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-Sequencing-AY054BerkiGEM2007-Sequencing-AY0542007-08-07T18:10:02Z<p>Ayu: </p>
<hr />
<div>ATCGTTAGCTTTCGCTAGGATGATTTCTGGATTCATGAGATCTGGCGGATAATGCTGCGAAAAGAAGCGTTTTTTTATGTAACATAATGCGACCAATAATCGTAATGAATATGAGAAGTGTGATATTATAACATTTCATGACTACTGCAAGACTAAAATTAACATGACAAGTCTGGTTTCCCTGGAAAATGTCTCGGTTTCTTTTGGCCAACGCCGCGTCCTCTCTGATGTGTCGCTGGAACTTAAACCTGGAAAAATTTTGAGGATCCTAACTCGAGCTGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCCTAACTACGCTACACTAGAAGAACAGTTATTTTGGTATCTGCGCTCTGCTGAAGCCAGTACCTTCGAAAAAGAGTTGGTAGCTCTTGATTCGGCCAACAACATCGCTGGGTAGCGTGTTTTTGGCTGCAGCAGCGATTACCGCCGCAGAAAAAGAATCTCAGAGAATCCTTTGATCTTCTACGGTCTGACCGCTCAATGAACGAAACTCACGTTAGAATTGCCATGAAATACAAAGGACTACCTGATCTCAATGAATGATTCAATCCAGCAG</div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurSequencingFilesTemplate:BerkiGEM2007 ArthurSequencingFiles2007-08-07T18:09:12Z<p>Ayu: /* Start 51 */</p>
<hr />
<div>'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 26|Skip to 26 Start]]'''<br />
<br><br />
'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 51|Skip to 51 Start]]'''<br />
{|<br />
|-<br />
|Sample||Date||Plasmid||Clone||Primer||Result||File Link<br />
|-<br />
|AY001||060407 ||pBca9145-Bca1145||#1||ca998||Probably good. Long, ambiguous long AAAAAAA.||[[BerkiGEM2007-Sequencing-AY001 | AY001]]<br />
|-<br />
|AY002||060407 ||pBca9145-Bca1145||#2||ca998||Good.||[[BerkiGEM2007-Sequencing-AY002 | AY002]]<br />
|-<br />
|AY003||061207||pBca9145-HPI/katG (I716253)||A1||ca998||super wrong. Seems like only half of HPI/katG, from the AY004.Sal.katG.HPI-Fx "mutate GAT>GAC (BglII)" til the end, was cloned.||[[BerkiGEM2007-Sequencing-AY003 | AY003]]<br />
|-<br />
|AY004||061207||pBca9145-HPI/katG (I716253)||A3||ca998||generally OK. There is one extra G at 584 in the goal plasmid in the calls file. There is low confidence, but I am not sure what to make of it. Possibly should send for recheck at this point; may be necessary to check the mutation point @1308, and the end portion as well. But based on the miniprep digest run yesterday, this guy has a high chance of being the right one. DECISION: sent as AY007 with G01001 for a reverse check.||[[BerkiGEM2007-Sequencing-AY004 | AY004]]<br />
|-<br />
|AY005||061207||pBca9145-HPI/katG (I716253)||A4||ca998||crazy :( there are big gaps||[[BerkiGEM2007-Sequencing-AY005 | AY005]]<br />
|-<br />
|AY006||061207||pBca9145-wbbL (I716000)||B1||ca998||also crazy||[[BerkiGEM2007-Sequencing-AY006 | AY006]]<br />
|-<br />
|AY007||061307||pBca9145-HPI/katG (I716???)||A3||G01001||Looks good actually, only notable thing is silent point mutation @ 1782 TCG > TCA still S. but the mutation point was just missed by sequencing. I don't think it's necessary to recheck; i have faith the primers worked right. well.. idk. major concern still is the possible addition mutation of a G||[[BerkiGEM2007-Sequencing-AY007 | AY007]]<br />
|-<br />
|AY008||061307||pBca9145-neuS (I716001)||C1||ca998||Forward. Looks great!||[[BerkiGEM2007-Sequencing-AY008 | AY008]]<br />
|-<br />
|AY009||061307||pBca9145-neuS (I716001)||C1||G01001||Reverse. Looks great!||[[BerkiGEM2007-Sequencing-AY009 | AY009]]<br />
|-<br />
|AY010||061407||I716002 (pBca9145-yfbE_promote)||D1||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C||[[BerkiGEM2007-Sequencing-AY010 | AY010]]<br />
|-<br />
|AY011||061407||I716002 (pBca9145-yfbE_promote)||D1||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY011 | AY011]]<br />
|-<br />
|AY012||061407||I716002 (pBca9145-yfbE_promote)||D4||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C. @640 addition of a C||[[BerkiGEM2007-Sequencing-AY012 | AY012]]<br />
|-<br />
|AY013||061407||I716002 (pBca9145-yfbE_promote)||D4||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY013 | AY013]]<br />
|-<br />
|AY014||061507||I716000 (pBca9145-wbbL)||E1||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T @ 812, but read quality is low here. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY014 | AY014]]<br />
|-<br />
|AY015||061507||I716000 (pBca9145-wbbL)||E2||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T at 801. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY015 | AY015]]<br />
|-<br />
|AY016||061807||I716000 (pBca9145-wbbL)||E1||G01001||good||[[BerkiGEM2007-Sequencing-AY016 | AY016]]<br />
|-<br />
|AY017||061807||I716000 (pBca9145-wbbL)||E2||G01001||good||[[BerkiGEM2007-Sequencing-AY017 | AY017]]<br />
|-<br />
|AY018||061807||I716253 (pBca9145-HPI/katG)||A3||ay007||good||[[BerkiGEM2007-Sequencing-AY018 | AY018]]<br />
|-<br />
|AY019||062107||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY019 | AY019]]<br />
|-<br />
|AY020||062107||I716006 (pBca9145-Bca9203 B5red)||G3||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY020 | AY020]]<br />
|-<br />
|AY021||062507||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||looks good||[[BerkiGEM2007-Sequencing-AY021 | AY021]]<br />
|-<br />
|AY022||062507||I716006 (pBca9145-Bca9203 B5red)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY022 | AY022]]<br />
|-<br />
|AY023||062507||I716005 (pBca9145-Bca9229 cytoB5)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY023 | AY023]]<br />
|-<br />
|AY024||062507||I716005 (pBca9145-Bca9229 cytoB5)||H4||ca998||looks good||[[BerkiGEM2007-Sequencing-AY024 | AY024]]<br />
|-<br />
|AY025||062807||I716002 (pBca9145-yfbE_promote)||IB||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY025 | AY025]]<br />
|}<br />
===Start 26===<br />
{|<br />
|-<br />
|AY026||062807||I716002 (pBca9145-yfbE_promote)||ID||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY026 | AY026]]<br />
|-<br />
|AY027||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J1||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY027 | AY027]]<br />
|-<br />
|AY028||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J2||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY028 | AY028]]<br />
|-<br />
|AY029||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J3||ca998||Ptet and wbbL were successfully cloned. neuS, unsure. Possibly neuS is gone since there could be a BamHI site right after wbbL in sequence file.||[[BerkiGEM2007-Sequencing-AY029 | AY029]]<br />
|-<br />
|AY030||071107||I716012 (101-008)||1||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY030 | AY030]]<br />
|-<br />
|AY031||071107||I716012 (101-008)||2||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY031 | AY031]]<br />
|-<br />
|AY032||071207||I716013 (pBca9145-yfbE-rbs-ATG)||1||ca998||V>A right after BglII site. Amino acid change is bad.||[[BerkiGEM2007-Sequencing-AY032 | AY032]]<br />
|-<br />
|AY033||071207||I716013 (pBca9145-yfbE-rbs-ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY033 | AY033]]<br />
|-<br />
|AY034||071207||I716014 (pBca9145-yfbE_solo)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY034 | AY034]]<br />
|-<br />
|AY035||071207||I716014 (pBca9145-yfbE_solo)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY035 | AY035]]<br />
|-<br />
|AY036||071207||I716014 (pBca9145-yfbE_solo)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY036 | AY036]]<br />
|-<br />
|AY037||071307||I716015 (RFP no ATG)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY037 | AY037]]<br />
|-<br />
|AY038||071307||I716015 (RFP no ATG)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY038 | AY038]]<br />
|-<br />
|AY039||071307||I716015 (RFP no ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY039 | AY039]]<br />
|-<br />
|AY040||071307||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet||[[BerkiGEM2007-Sequencing-AY040 | AY040]]<br />
|-<br />
|AY041||071707||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet AGAIN - but the sequencing is extremely mixed.||[[BerkiGEM2007-Sequencing-AY041 | AY041]]<br />
|-<br />
|AY042||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||ca998||T7 promoter, CytB5 and the first part of CytB5Red cloned successfully. 591 it is ambiguous if the base is right or not (CytB5Red) but data from Austin's I716011 sequence suggests that it is good.||[[BerkiGEM2007-Sequencing-AY042 | AY042]]<br />
|-<br />
|AY043||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||G01001||dblTerm and the rest of CytB5Red was cloned successfully.||[[BerkiGEM2007-Sequencing-AY043 | AY043]]<br />
|-<br />
|AY044||072307||I716008||R1||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY044 | AY044]]<br />
|-<br />
|AY045||072307||I716008||R2||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY045 | AY045]]<br />
|-<br />
|AY046||072307||I716008||R3||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY046 | AY046]]<br />
|-<br />
|AY047||072307||I716008||R4||ca998||Ptet intact. RBS appears garbled but it's because N's were not placed in the I716008 for the library. Need to map to check for neuS.||[[BerkiGEM2007-Sequencing-AY047 | AY047]]<br />
|-<br />
|AY048||072307||I716008||R5||ca998||wtf is this lol||[[BerkiGEM2007-Sequencing-AY048 | AY048]]<br />
|-<br />
|AY049||072307||I716008||R6||ca998||half of ptet is missing||[[BerkiGEM2007-Sequencing-AY049 | AY049]]<br />
|-<br />
|AY050||072307||I716008||R7||ca998||wtf is this||[[BerkiGEM2007-Sequencing-AY050 | AY050]]<br />
|}<br />
===Start 51===<br />
{|<br />
|-<br />
|AY051||072307||I716008||R8||ca998||half ptet missing||[[BerkiGEM2007-Sequencing-AY051 | AY051]]<br />
|-<br />
|AY052||072307||I716008||r9||ca998||wtf||[[BerkiGEM2007-Sequencing-AY052 | AY052]]<br />
|-<br />
|AY053||072607||I716012|| ||ca998||M.I.A.||[[BerkiGEM2007-Sequencing-AY053 | AY053]]<br />
|-<br />
|AY054||080607||I716026||V1||ca998||Great||[[BerkiGEM2007-Sequencing-AY054 | AY054]]<br />
|-<br />
|AY055||080607||I716026||V2||ca998||Great||[[BerkiGEM2007-Sequencing-AY055 | AY055]]<br />
|-<br />
|AY056||080607||I716026||V3||ca998||A -> G at position 136 in the sequence file||[[BerkiGEM2007-Sequencing-AY056 | AY056]]<br />
|-<br />
|AY057||080607||I716028||W1||ca998||T->C @ 269, G->T @ 539||[[BerkiGEM2007-Sequencing-AY057 | AY057]]<br />
|-<br />
|AY058||080607||I716028||W2||ca998||deletions and stuff, whoa||[[BerkiGEM2007-Sequencing-AY058 | AY058]]<br />
|-<br />
|AY059||080607||I716028||W3||ca998||Great||[[BerkiGEM2007-Sequencing-AY059 | AY059]]<br />
|-<br />
|AY060||080607||I716029||X1||ca998||Great||[[BerkiGEM2007-Sequencing-AY060 | AY060]]<br />
|-<br />
|AY061||080607||I716029||X2||ca998||A->G @ 531||[[BerkiGEM2007-Sequencing-AY061 | AY061]]<br />
|-<br />
|AY062||080607||I716029||X3||ca998||Great||[[BerkiGEM2007-Sequencing-AY062 | AY062]]<br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurSequencingFilesTemplate:BerkiGEM2007 ArthurSequencingFiles2007-08-07T18:01:19Z<p>Ayu: /* Start 51 */</p>
<hr />
<div>'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 26|Skip to 26 Start]]'''<br />
<br><br />
'''[[Template:BerkiGEM2007_ArthurSequencingFiles#Start 51|Skip to 51 Start]]'''<br />
{|<br />
|-<br />
|Sample||Date||Plasmid||Clone||Primer||Result||File Link<br />
|-<br />
|AY001||060407 ||pBca9145-Bca1145||#1||ca998||Probably good. Long, ambiguous long AAAAAAA.||[[BerkiGEM2007-Sequencing-AY001 | AY001]]<br />
|-<br />
|AY002||060407 ||pBca9145-Bca1145||#2||ca998||Good.||[[BerkiGEM2007-Sequencing-AY002 | AY002]]<br />
|-<br />
|AY003||061207||pBca9145-HPI/katG (I716253)||A1||ca998||super wrong. Seems like only half of HPI/katG, from the AY004.Sal.katG.HPI-Fx "mutate GAT>GAC (BglII)" til the end, was cloned.||[[BerkiGEM2007-Sequencing-AY003 | AY003]]<br />
|-<br />
|AY004||061207||pBca9145-HPI/katG (I716253)||A3||ca998||generally OK. There is one extra G at 584 in the goal plasmid in the calls file. There is low confidence, but I am not sure what to make of it. Possibly should send for recheck at this point; may be necessary to check the mutation point @1308, and the end portion as well. But based on the miniprep digest run yesterday, this guy has a high chance of being the right one. DECISION: sent as AY007 with G01001 for a reverse check.||[[BerkiGEM2007-Sequencing-AY004 | AY004]]<br />
|-<br />
|AY005||061207||pBca9145-HPI/katG (I716253)||A4||ca998||crazy :( there are big gaps||[[BerkiGEM2007-Sequencing-AY005 | AY005]]<br />
|-<br />
|AY006||061207||pBca9145-wbbL (I716000)||B1||ca998||also crazy||[[BerkiGEM2007-Sequencing-AY006 | AY006]]<br />
|-<br />
|AY007||061307||pBca9145-HPI/katG (I716???)||A3||G01001||Looks good actually, only notable thing is silent point mutation @ 1782 TCG > TCA still S. but the mutation point was just missed by sequencing. I don't think it's necessary to recheck; i have faith the primers worked right. well.. idk. major concern still is the possible addition mutation of a G||[[BerkiGEM2007-Sequencing-AY007 | AY007]]<br />
|-<br />
|AY008||061307||pBca9145-neuS (I716001)||C1||ca998||Forward. Looks great!||[[BerkiGEM2007-Sequencing-AY008 | AY008]]<br />
|-<br />
|AY009||061307||pBca9145-neuS (I716001)||C1||G01001||Reverse. Looks great!||[[BerkiGEM2007-Sequencing-AY009 | AY009]]<br />
|-<br />
|AY010||061407||I716002 (pBca9145-yfbE_promote)||D1||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C||[[BerkiGEM2007-Sequencing-AY010 | AY010]]<br />
|-<br />
|AY011||061407||I716002 (pBca9145-yfbE_promote)||D1||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY011 | AY011]]<br />
|-<br />
|AY012||061407||I716002 (pBca9145-yfbE_promote)||D4||ca998||Perfect promoter cloned region. @ 443 there is a deletion of ttgcag. Point mutation @631, T > C. @640 addition of a C||[[BerkiGEM2007-Sequencing-AY012 | AY012]]<br />
|-<br />
|AY013||061407||I716002 (pBca9145-yfbE_promote)||D4||G01001||Mixed DNA tube (contamination)||[[BerkiGEM2007-Sequencing-AY013 | AY013]]<br />
|-<br />
|AY014||061507||I716000 (pBca9145-wbbL)||E1||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T @ 812, but read quality is low here. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY014 | AY014]]<br />
|-<br />
|AY015||061507||I716000 (pBca9145-wbbL)||E2||ca998||long stretch of t's at 696, sequencing got an extra one. Likely read error. Missing a T at 801. Lack of agttgca right after insert?? maybe not??||[[BerkiGEM2007-Sequencing-AY015 | AY015]]<br />
|-<br />
|AY016||061807||I716000 (pBca9145-wbbL)||E1||G01001||good||[[BerkiGEM2007-Sequencing-AY016 | AY016]]<br />
|-<br />
|AY017||061807||I716000 (pBca9145-wbbL)||E2||G01001||good||[[BerkiGEM2007-Sequencing-AY017 | AY017]]<br />
|-<br />
|AY018||061807||I716253 (pBca9145-HPI/katG)||A3||ay007||good||[[BerkiGEM2007-Sequencing-AY018 | AY018]]<br />
|-<br />
|AY019||062107||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY019 | AY019]]<br />
|-<br />
|AY020||062107||I716006 (pBca9145-Bca9203 B5red)||G3||ca998||fail, mixed sample?? I believe it's quintara's fault||[[BerkiGEM2007-Sequencing-AY020 | AY020]]<br />
|-<br />
|AY021||062507||I716006 (pBca9145-Bca9203 B5red)||G1||ca998||looks good||[[BerkiGEM2007-Sequencing-AY021 | AY021]]<br />
|-<br />
|AY022||062507||I716006 (pBca9145-Bca9203 B5red)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY022 | AY022]]<br />
|-<br />
|AY023||062507||I716005 (pBca9145-Bca9229 cytoB5)||H3||ca998||looks good||[[BerkiGEM2007-Sequencing-AY023 | AY023]]<br />
|-<br />
|AY024||062507||I716005 (pBca9145-Bca9229 cytoB5)||H4||ca998||looks good||[[BerkiGEM2007-Sequencing-AY024 | AY024]]<br />
|-<br />
|AY025||062807||I716002 (pBca9145-yfbE_promote)||IB||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY025 | AY025]]<br />
|}<br />
===Start 26===<br />
{|<br />
|-<br />
|AY026||062807||I716002 (pBca9145-yfbE_promote)||ID||ca998||our proprietary yfbE was cloned successfully||[[BerkiGEM2007-Sequencing-AY026 | AY026]]<br />
|-<br />
|AY027||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J1||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY027 | AY027]]<br />
|-<br />
|AY028||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J2||ca998||wbbL or neuS not cloned. only Ptet.||[[BerkiGEM2007-Sequencing-AY028 | AY028]]<br />
|-<br />
|AY029||070507||I716008 (Ptet-rbs-wbbL-rbs-neuS)||J3||ca998||Ptet and wbbL were successfully cloned. neuS, unsure. Possibly neuS is gone since there could be a BamHI site right after wbbL in sequence file.||[[BerkiGEM2007-Sequencing-AY029 | AY029]]<br />
|-<br />
|AY030||071107||I716012 (101-008)||1||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY030 | AY030]]<br />
|-<br />
|AY031||071107||I716012 (101-008)||2||ca998||Could not amplify||[[BerkiGEM2007-Sequencing-AY031 | AY031]]<br />
|-<br />
|AY032||071207||I716013 (pBca9145-yfbE-rbs-ATG)||1||ca998||V>A right after BglII site. Amino acid change is bad.||[[BerkiGEM2007-Sequencing-AY032 | AY032]]<br />
|-<br />
|AY033||071207||I716013 (pBca9145-yfbE-rbs-ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY033 | AY033]]<br />
|-<br />
|AY034||071207||I716014 (pBca9145-yfbE_solo)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY034 | AY034]]<br />
|-<br />
|AY035||071207||I716014 (pBca9145-yfbE_solo)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY035 | AY035]]<br />
|-<br />
|AY036||071207||I716014 (pBca9145-yfbE_solo)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY036 | AY036]]<br />
|-<br />
|AY037||071307||I716015 (RFP no ATG)||1||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY037 | AY037]]<br />
|-<br />
|AY038||071307||I716015 (RFP no ATG)||2||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY038 | AY038]]<br />
|-<br />
|AY039||071307||I716015 (RFP no ATG)||3||ca998||Perfection||[[BerkiGEM2007-Sequencing-AY039 | AY039]]<br />
|-<br />
|AY040||071307||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet||[[BerkiGEM2007-Sequencing-AY040 | AY040]]<br />
|-<br />
|AY041||071707||I716008 Ptet-wbbL-neuS||lib||ca998||really weird I think it's missing half of Ptet AGAIN - but the sequencing is extremely mixed.||[[BerkiGEM2007-Sequencing-AY041 | AY041]]<br />
|-<br />
|AY042||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||ca998||T7 promoter, CytB5 and the first part of CytB5Red cloned successfully. 591 it is ambiguous if the base is right or not (CytB5Red) but data from Austin's I716011 sequence suggests that it is good.||[[BerkiGEM2007-Sequencing-AY042 | AY042]]<br />
|-<br />
|AY043||071907||I716019 (t7-rbs-cytB5-rbs-cytB5red-dblterm)||lib||G01001||dblTerm and the rest of CytB5Red was cloned successfully.||[[BerkiGEM2007-Sequencing-AY043 | AY043]]<br />
|-<br />
|AY044||072307||I716008||R1||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY044 | AY044]]<br />
|-<br />
|AY045||072307||I716008||R2||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY045 | AY045]]<br />
|-<br />
|AY046||072307||I716008||R3||ca998||half of ptet missing||[[BerkiGEM2007-Sequencing-AY046 | AY046]]<br />
|-<br />
|AY047||072307||I716008||R4||ca998||Ptet intact. RBS appears garbled but it's because N's were not placed in the I716008 for the library. Need to map to check for neuS.||[[BerkiGEM2007-Sequencing-AY047 | AY047]]<br />
|-<br />
|AY048||072307||I716008||R5||ca998||wtf is this lol||[[BerkiGEM2007-Sequencing-AY048 | AY048]]<br />
|-<br />
|AY049||072307||I716008||R6||ca998||half of ptet is missing||[[BerkiGEM2007-Sequencing-AY049 | AY049]]<br />
|-<br />
|AY050||072307||I716008||R7||ca998||wtf is this||[[BerkiGEM2007-Sequencing-AY050 | AY050]]<br />
|}<br />
===Start 51===<br />
{|<br />
|-<br />
|AY051||072307||I716008||R8||ca998||half ptet missing||[[BerkiGEM2007-Sequencing-AY051 | AY051]]<br />
|-<br />
|AY052||072307||I716008||r9||ca998||wtf||[[BerkiGEM2007-Sequencing-AY052 | AY052]]<br />
|-<br />
|AY053||072607||I716012|| ||ca998||M.I.A.||[[BerkiGEM2007-Sequencing-AY053 | AY053]]<br />
|-<br />
|AY054||080607||I716026||V1||ca998|| ||[[BerkiGEM2007-Sequencing-AY054 | AY054]]<br />
|-<br />
|AY055||080607||I716026||V2||ca998|| ||[[BerkiGEM2007-Sequencing-AY055 | AY055]]<br />
|-<br />
|AY056||080607||I716026||V3||ca998|| ||[[BerkiGEM2007-Sequencing-AY056 | AY056]]<br />
|-<br />
|AY057||080607||I716028||W1||ca998|| ||[[BerkiGEM2007-Sequencing-AY057 | AY057]]<br />
|-<br />
|AY058||080607||I716028||W2||ca998|| ||[[BerkiGEM2007-Sequencing-AY058 | AY058]]<br />
|-<br />
|AY059||080607||I716028||W3||ca998|| ||[[BerkiGEM2007-Sequencing-AY059 | AY059]]<br />
|-<br />
|AY060||080607||I716029||X1||ca998|| ||[[BerkiGEM2007-Sequencing-AY060 | AY060]]<br />
|-<br />
|AY061||080607||I716029||X2||ca998|| ||[[BerkiGEM2007-Sequencing-AY061 | AY061]]<br />
|-<br />
|AY062||080607||I716029||X3||ca998|| ||[[BerkiGEM2007-Sequencing-AY062 | AY062]]<br />
|}</div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile30BerkiGEM2007-ArthurConstructionFile302007-08-03T22:22:35Z<p>Ayu: </p>
<hr />
<div><pre><br />
making basic biobrick I716028 and 29 - Mg2+ repressed promoter (p-mgrB)<br />
<br />
[pcr] AY021/22 21/23 onto MG1655 genome (550 bp, BglII/XhoI)<br />
put it into pBca9145<br />
you get I716028 and I716029<br />
<br />
<br />
mgrB attempt by yu (550 bp)<br />
AY021 (f) catggAGATCTtgagagtaagaacctgtcgg <br />
AY022 (r1) gtacaCTCGAGttaGGATCCgtttcacctaccttatgtc<br />
AY023 (r2) gtacaCTCGAGttaGGATCCcgaaactttttcactccaatc<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile29BerkiGEM2007-ArthurConstructionFile292007-08-03T22:22:25Z<p>Ayu: </p>
<hr />
<div><pre><br />
combine hemeA + cytB5 stuff<br />
<br />
I716027 hemA + cytB5 cassette<br />
[dig] pBca1101-Bca1106A (BamHI/XhoI, 3344+9, L)<br />
[dig] I716019 (BglII/XhoI, 2063+1401, S)<br />
[ligate] get I716027<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile28BerkiGEM2007-ArthurConstructionFile282007-08-03T22:22:17Z<p>Ayu: </p>
<hr />
<div><pre><br />
making basic biobrick I716026 - Zinc repressed promoter (p-zhuC)<br />
<br />
[pcr] AY019/20 onto MG1655 genome (251 bp, BglII/XhoI)<br />
put it into pBca9145<br />
you get I716026<br />
<br />
<br />
AY019 // catggAGATCTggcggataatgctgcgaaaag<br />
AY020 // gtacaCTCGAGttaGGATCCtcaaaatttttccaggttta<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile27BerkiGEM2007-ArthurConstructionFile272007-08-03T22:21:53Z<p>Ayu: </p>
<hr />
<div><pre><br />
making I716025 - VHb vitreoscilla hemoglobin basic part<br />
NdeI/BglII petDUET1 style<br />
<br />
[pcr] AY017/18 onto pRED2 (460 bp, NdeI/BglII)<br />
put it into petDUET1<br />
you get I716025<br />
<br />
AY017 // catggCATatgttagaccagcaaacc<br />
AY018 // gtacaAGATCTttattcaaccgcttgagcg<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile26BerkiGEM2007-ArthurConstructionFile262007-08-03T22:21:37Z<p>Ayu: </p>
<hr />
<div><pre><br />
making I716024 - VHb vitreoscilla hemoglobin basic part<br />
<br />
[pcr] AY015/16 onto pRED2 (472 bp, BglII/XhoI)<br />
put it into pBca9145<br />
you get I716024 (pBca9145-VHb)<br />
<br />
<br />
AY015 // catggAGATCTatgttagaccagcaaacc<br />
AY016 // gtacaCTCGAGttaGGATCCttattcaaccgcttgagcg<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/BerkiGEM2007-ArthurConstructionFile25BerkiGEM2007-ArthurConstructionFile252007-08-03T22:21:26Z<p>Ayu: </p>
<hr />
<div><pre><br />
construct Ptet-wbbL-neuS the old fashioned way<br />
<br />
[dig] pSB1A2-Bca9296 XbaI/AlwNI, 2698+1525, L<br />
[dig] pSB1A2-r0040 SpeI/AlwNI, 1587+ 546, L<br />
[ligate] get I716023<br />
</pre></div>Ayuhttp://2007.igem.org/wiki/index.php/Template:BerkiGEM2007_ArthurConstructionFilesTemplate:BerkiGEM2007 ArthurConstructionFiles2007-08-03T22:21:18Z<p>Ayu: </p>
<hr />
<div>6/6 [[BerkiGEM2007-ArthurConstructionFile1 | Bbrick ORF wbbL from pJ23006-Bca9106]]<br><br />
6/6 [[BerkiGEM2007-ArthurConstructionFile2 | Bbrick ORF neuS from pJ23006-Bca9106]]<br><br />
6/8 [[BerkiGEM2007-ArthurConstructionFile3 | Bbrick yfbE from MG1665]]<br><br />
<del>6/15 [[BerkiGEM2007-ArthurConstructionFile4 | I716003a (pBca9145- cmr cass+rbs+neuS)]]</del><br><br />
6/15 [[BerkiGEM2007-ArthurConstructionFile5 | I716004 (pBca9145- yfbE_pro-rbs-RFP)]]<br><br />
6/19 [[BerkiGEM2007-ArthurConstructionFile6 | composite part <cm><rbs><neuS> (library)]]<br><br />
6/19 [[BerkiGEM2007-ArthurConstructionFile7 | composite part <kan><rbs><wbbL> (library)]]<br><br />
6/26 [[BerkiGEM2007-ArthurConstructionFile8 | I716008 (Ptet-rbs-wbbL-rbs-neuS)]]<br><br />
<del>6/27 [[BerkiGEM2007-ArthurConstructionFile9 | I716009 cytB5+cytB5red]]</del><br><br />
6/28 [[BerkiGEM2007-ArthurConstructionFile10 | I716009 (cm+rbs+cytB5)]]<br><br />
6/28 [[BerkiGEM2007-ArthurConstructionFile11 | I716010 (kan+rbs+cytB5red)]]<br><br />
7/2 [[BerkiGEM2007-ArthurConstructionFile12 | I716011 cm-rbs-cytB5-rbs-cytB5red]]<br><br />
7/2 [[BerkiGEM2007-ArthurConstructionFile13 | I716012 ptet/rbs/wbbL/rbs/neuS in lo copy]]<br><br />
7/3 [[BerkiGEM2007-ArthurConstructionFile14 | yfbE try 2 I716013 I716014 I716015]]<br><br />
7/10 [[BerkiGEM2007-ArthurConstructionFile15 | I716013 (pBca9145-yfbE-rbs-ATG)]]<br><br />
7/10 [[BerkiGEM2007-ArthurConstructionFile16 | I716014 (pBca9145-yfbE_solo)]]<br><br />
7/10 [[BerkiGEM2007-ArthurConstructionFile17 | I716015 (pBca9145-RFP_noATG)]]<br><br />
7/13 [[BerkiGEM2007-ArthurConstructionFile18 | I716016 (yfbE-rbs-RFP_jp)]]<br><br />
7/19 [[BerkiGEM2007-ArthurConstructionFile19 | I716017 (yfbE-rbs-RFP)]]<br><br />
7/16 [[BerkiGEM2007-ArthurConstructionFile20 | I716018 (t7-cytb5-red)]]<br><br />
7/17 [[BerkiGEM2007-ArthurConstructionFile21 | I716019 (t7-cytb5-red-term)]]<br><br />
7/19 [[BerkiGEM2007-ArthurConstructionFile22 | I716020 (pBca1176) (CmR-colE1 on locopy)]]<br><br />
7/19 [[BerkiGEM2007-ArthurConstructionFile23 | I716021 (pSal-CmR-colE1 on locopy)]]<br><br />
7/19 [[BerkiGEM2007-ArthurConstructionFile24 | I716022 (p_yfbE-CmR-colE1 on locopy)]]<br><br />
7/30 [[BerkiGEM2007-ArthurConstructionFile25 | I716023 (ptet-rbs-wbbL-rbs-neuS)]]<br><br />
7/31 [[BerkiGEM2007-ArthurConstructionFile26 | I716024 (VHb from pRED2)]]<br><br />
7/31 [[BerkiGEM2007-ArthurConstructionFile27 | I716025 ((NcoI-EcoRI) VHb from pRED2)]]<br><br />
7/31 [[BerkiGEM2007-ArthurConstructionFile28 | I716026 ( p-zhuC)]]<br><br />
7/31 [[BerkiGEM2007-ArthurConstructionFile29 | I716027 (hemA+cytB5cassette)]]<br><br />
7/31 [[BerkiGEM2007-ArthurConstructionFile30 | I716028 I716029 (p-mgrB)]]<br></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-03T22:12:43Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/3 dry ice dry ice dry ice dry ice==<br />
* 27 28 29 plated<br />
* wbbL/neuS: incubating. ON culture will be used tmrw in assay.<br />
* plates<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-08-01T23:41:02Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==8/1 AUG 1 '07 telebears pt 2==<br />
* I716023 miniprepped and transformed into MC828 for O antigen testing<br />
* I716027 picked 4 guys and incubating<br />
* PCR did before leaving, for znuC and mgrB promoters.<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-07-31T23:32:09Z<p>Ayu: /* 7/31 my green pipette is missing */</p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# one clone worked! it's the lysed one in the following picture<br />
[[Image:073107_assay.jpg]]<br />
* made oligos for<br />
# Vitreosilla sp. VHb hemoglobin<br />
# zinc promoter<br />
# Mg promoter<br />
<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/Arthur_Yu_NotebookArthur Yu Notebook2007-07-31T18:02:30Z<p>Ayu: </p>
<hr />
<div>__NOTOC__<br />
[[Template:BerkiGEM2007_ArthurConstructionFiles | My Construction Files]]<br><br />
[[Template:BerkiGEM2007_ArthurSequencingFiles | My Sequencing Files]]<br><br><br />
----<br />
==7/31 my green pipette is missing==<br />
* wbbL/neuS assay on I716023 (w/ and w/o K1 phage)<br />
# results tba<br />
==7/30 vitreoscilla rly?==<br />
* Made I716023, which is the wbbL neuS biobrick 1.0 style.<br />
* did some reading to find promoter for sam<br />
==7/26 still trying==<br />
* I716020 repeat creation is funny, not white. colony pcr says...<br />
[[Image:072607_gel1.jpg|300px]]<br />
* I716008 sent for reverse sequencing to get a complete picture (is it really good? am I just messing up in making I716012?)<br />
<br />
==7/25 few have won==<br />
* I716020 not successfully made. none were red, and the E/Ba digest gel looked really really funny (4.7k, 3k, 2k; expected was 4.9k, 0.9k)<br />
* it was religated and we will see tomorrow how the plate is<br />
* I716012 lol k put in incushaker tubes, we will see tomorrow how the tubes is<br />
<br />
==7/24 many will enter few will win==<br />
* There was one clone of the I716008 that looked good: R4<br />
* a test digest suggests that it is 100% correct<br />
* But the triple digest, while having a 2150 band that I wanted, seemed to only have one 1100 or 900 band. Weird<br />
* transformed into MC828 and MC828E anyway, hopefully it works tmrw<br />
==7/23 another day==<br />
* iron "UCB" "IGEM 07" redone<br />
* I716008 9 minipreps done, each a diff clone, and sent for forward sequencings.<br />
* I716020 plated.<br />
==7/20 Untitled 2==<br />
* I716019 found to be created correctly. (t7-rbs-cytB5-rbs-cytB5red-dblterm) see ay42 and ay43<br />
[[Image:072007_yfbEgraph.jpg]]<br />
<br><br />
'''[[072007_neg | White Cell Negative]]'''<br />
<br />
==7/19 Untitled==<br />
* so the sequencing for wbbL/neuS showed up really mixy and funny. Seems like 1/8 to 1/4 of the library has success though, so I will replate and then mini individual colonies and sequence each one til I find a winner.<br />
* yfbE assay was a success. Crisis averted by finding "Laser On" option in FlowCyto program.<br />
* cytB5/red cassette completed and sent to quintara for sequencing.<br />
==7/18 A's take Rangers to school==<br />
* A's mediocre, Rangers pretty bad<br />
* I put 12 into the wrong cell >_< well sequencing shows that I'm missing half the promoter anyway so... meh<br />
* yfbE iron promoter workses (P series). See pic on right. [[Image:071807_yfbE.jpg|300px|right]]<br />
==7/17 yaeyeayea ==<br />
* iron stuff growing tubes. 16 tubes, 4+4 clones jp style and not<br />
* 12 and 19 are growing plate.<br />
==7/16 four ligations==<br />
* the sequencing for wbbL/neuS library seems like Ptet is cut out. bleh doing again<br />
* made I716008, I716018, I716017, I716016 and plated<br />
==7/13 friday==<br />
* the RFP without ATG looks good (sequencing)<br />
* wbbl/neuS lib didn't work again hmm, sent for sequencing<br />
* other stuff will insert later<br />
==7/12 efficiency==<br />
[[Image:071207_ayu_gel2.jpg|100px|right]]<br />
*got news that I716012 didn't sequence well, trying amplify<br />
*incubated I716015 (pBca9145-RFP_noATG)<br />
*miniprepped yfbE's (I716013 and I716014)<br />
*plated proprietary I716016 on FeCl3 and without<br />
*new yfbE stuff for sequencing<br />
*running gel on I716015 pcr prod to expediate testing<br />
*redo I716012 again<br />
# digesting 101 and 008<br />
# growing up electrocompetant MC828E<br />
<br />
remarks<br />
austin said cytochrome b5 /b5 red was pretty. yeayeayeayaeyea<br />
==7/11 seven eleven==<br />
[[Image:071107_ayu_gel1.jpg|100px|left]]<br />
[[Image:071107_ayu_gel2.jpg|100px|right]]<br />
* miniprep'd wbbL/neuS funny thing<br />
# restriction map looks funny (see right)<br />
# sent it for sequencing.<br />
* poured super special david plates<br />
* basic parted RFP without start ATG, and plated.<br />
# see picture validating it's coolness on left.<br />
* cleaned my bench and austin bench<br />
==7/10 another day==<br />
* yfbE w/ and w/o rbs-ATG basic part'd (I716013, I716014)<br />
* did an assay on wbbL/neuS - no lysing occurred with K1 phage.<br />
# growing up for miniprep then sequencing tmrw.<br />
==7/9 MISSING OLIGOS==<br />
* So my ay013 and ay014 are missing lols, amin will order more !<br />
* Fresh I716012 plated onto some fresh MC828E.<br />
* i helped austin with some minipreps.<br />
==7/6 seven-six-oh-seven==<br />
* J1 and J2 are bad, J3 has a high chance of bad<br />
# remaking I716008. digesting J3 in case it's good.<br />
# doesn't look good. Xformed some newly made 716008.<br />
==7/5 confusing #8==<br />
* digest pcr products 1 and 2 + clean<br />
* make kan plates<br />
* miniprep I716011<br />
* digest I716008 (it's bad)<br />
* made mC828E<br />
* send I716008 for sequencing<br />
* make LB and agar<br />
==7/4 needs more firework==<br />
* I716011<br />
# tryin it again...<br />
* I716012 put in incubator<br />
<br />
==7/3 yfbe new! and other stuff==<br />
* I716012 ptet-rbs-wbbL-rbs-neuS in lo copy<br />
[[Image:070307_ayu_gel1.jpg|100px|right]]<br />
# has issues with digestion. double digests look great, but triple digest still fuzzy<br />
# two ligations of this done, one with double digest (took both fragments) and one with triple (took invisibly place where it should be)<br />
# plated on mc868e that was saved from yesterday OMG I HOPE IT WORKS<br />
* pcr done of yfbE, with ATG on end, and without the ATG or the rbs.<br />
# SEE RIGHT FOR PICTURE (yfbE w/ ATG, w/o stuff, and RFP)<br />
* speaking of RFP, the oligos I made were for a different plasmid RFP. Ohhh boy<br />
==7/2 july already?==<br />
* I716011 cm-rbs-cytB5-rbs-cytB5red plated<br />
* I716008 ptet/rbs/wbbL/rbs/neuS (EcoRI, BamHI, AlwNI) 2146+1510+553, largest<br />
# overnight digest test because it messed up during the day.<br />
# will put into david plasmid tmrw.<br />
* yfbE primers ordered. also two for getting RFP.<br />
==6/30 omg weekend rly?==<br />
* miniprep party <del>I716009</del>, I716010, I716008, 9229 Right, 9203 Right, 1090 Left<br />
==6/29 public market woot==<br />
* yeaa I got up late and didn't do much today.<br />
* cultured some cells from plates, oh boy!<br />
* so boring I didn't even make an agenda .txt file on the comp.<br />
==6/28 /shruggery==<br />
* incubator at 25 C. wtf.<br />
<del>* 1-2-3ing step 1 now..</del> i forgot to do rbs's. lol.<br />
* xform I716010 (kan+rbs+cytB5red)<br />
* xform I716009 (cm+rbs+cytB5)<br />
* 1-2-3 xform Left 1090 (rbs)<br />
* 1-2-3 xform Right 716005 #G3 (9229)<br />
* 1-2-3 xform Right 716006 #H? (9203)<br />
[[User:Ayu|Ayu]] 21:01, 28 June 2007 (EDT)<br />
<br />
==6/27 growth curve fun==<br />
* Updated registry! yayyyyy<br />
* growth curve on yfbE/rbs/RFP<br />
# :( no phenotype observed for iron thing.<br />
# Sent IB and ID clones of it for sequencing.<br />
# Xformed the aforementioned minipreps into M65 (??) cells that should turn blue (or not?)<br />
* I716008 (Ptet-rbs-wbbL-rbs-neuS) made and xform'd<br />
* incubated Lefty+Righty<br />
<br />
==6/26 dehumidifier machine is still loud==<br />
* Bca9229 and Bca9203 look great (G1, G2, H3, H4) (ay021, 022, 023, 024)<br />
* poured plates<br />
* yfbE works. like 2x. will do growth curve tmrw.<br />
* xformed H4 into Righty, G1+G2 into Lefty<br />
==6/25 dehumidifier machine is loud==<br />
* Sent G1 and G2 for resequencing, cuz they didn't work.<br />
[[Image:062507_ayu_gel1.jpg|100px|right]]<br />
* test digest yfbE try #2<br />
# BglII/XhoI<br />
* miniprep 9229 then test digest<br />
# BglII/XhoI - looking for two bands<br />
* 9229 H4,H3 sent for F sequencing w/ ca998 (023,024)<br />
* yfbE incubated in Fe(II)SO4 instead of Fe(III)Cl3. Hope it works!<br />
GEL: h4, h3, h2, iD, iB, iA, ladder<br />
==6/24 lol weekend==<br />
* incubated yfbE w/ and w/o Fe, and 9229.<br />
==6/22 floodrly?==<br />
* floodrly?<br />
==6/21 ok==<br />
[[Image:062107_ayu_gel2.jpg|100px|left]]<br />
[[Image:062107_ayu_gel1.jpg|100px|right]]<br />
* yfbE and neuS didn't work. wbbL was good.<br />
# Chris redoes them all<br />
# and all are plated. yfbE gets extra love with a 20 uL iron plate extra.<br />
* B5 synth'd thing, miniprep'd<br />
# Let's call it I716005<br />
# looks ok from picture... sending G1 and G3 for forward sequencing.<br />
* Bca9229 - B5 thing, placed into austin digest with BglII/XhoI, xformed<br />
IMGS: (<< Left) The B5 reductase (?) digest looks good.<br><br />
(>> Right) The digested gel to purify was good. [yfbE, neuS, 1122x3, 1121x3, wbbL]<br><br />
<br />
==6/20 oops==<br />
[[Image:062007_ayu_gel2.jpg|100px|left]]<br />
* yfbE irony thing... fail<br />
[[Image:062007_ayu_gel1.jpg|100px|right]]<br />
# (BAD) w/ and w/o FeCl3 had no difference<br />
# did mini of the F1, F2, F3 xformed and incubated stuff<br />
# (>> digested mini with EcoRI/BamHI and got the band pattern of the parent vector (1100-1109). So failed xformation.<br />
# I was looking for 3k and a 400, not a 3k and a 1250.<br />
# (FIX) Got good digest of 1100-1109 from Chris, and put with new digest of yfbE to incubate on a plate.<br />
* wbbL and neuS... no colonies on the plate (fail)<br />
# (BAD) I believe I plated wrong.<br />
# <<) A digestion of the miniprep looks fine (so 1121 and 1122 parent plasmids OK)<br />
# And pretty sure that wbbL and neuS were good, and that I cut out bands right.<br />
# (FIX) Redid incubating and plating.<br />
[[User:Ayu|Ayu]] 16:58, 20 June 2007 (EDT)<br />
<br />
==6/19 safety is everyone's job==<br />
* ;-)<br />
* Sequencing received, looks good (ay05,ay06: ay016-18) see seq page<br />
* neuS and wbbL xform'd into 1121 and 1122 libraries. Plated<br />
* F1-4 (yfbE) incushakin, w/ and w/o FeCl3, to test promoter activity<br />
* G1-4 incushakin: B5 (synthesized guy)<br />
<br><br />
''random'': woot new fridge! looks quite secksy <3<br />
==6/18 speaker party==<br />
* xform'd lotta stuff<br />
* miniprep<br />
* pour plates<br />
* sent wbbL for rev sequencing<br />
* sent HPI/katG for middle sequencing ([ay06] name/ay018 prim/ay007)<br />
<br><br />
''other'': set up speaker sys. need M-M cable. woot.<br />
==6/15 digestion party==<br />
* Good D1, D4<br />
* synthy plasmid thingy...<br />
# [digest] kristin B4 for backbone. Used EcoRI/XhoI purified L<br />
# [digest] synthy plasmid thingy for insert. Used EcoRI/XhoI purified S<br />
* I716003a (pBca9145- cmr cass+rbs+neuS)<br />
# [digest] pBca9145-neuS (I716001) (BglII, XhoI; 2063+1245; S)<br />
# [digest] pBca1101-I716051 (BamHI, XhoI; 3119+ 850; L)<br />
* pBca9145-yfbE_pro-rbs-RFP (I716004)<br />
# [digest] pBca9145-yfbE_promote (I716002) (EcoRI/BamHI, 2063+ 421, S)<br />
# [digest] pBca1100-Bca1109 (EcoRI/BamHI, 2927+1253, L)<br />
* wbbL<br />
[[Image:061507_ayu_gel1.jpg|100px|right]]<br><br />
# miniprep'd and ready to go!<br />
# [IMAGE] of gel to the right: E1/E2/E3/E4/ladder >>><br />
# Sent E1 and E2 for sequencing, forward (ay014, ay015)<br />
<br><br><br />
''NOtes'': STILL NEED TO ENTER YFBE PROMOTER PART LOL entering composite parts would be nice too<br><br />
I did 10 digestions today. I'm proud of myself.<br />
==6/14 stuff about things==<br />
* neuS clone C1: WE HAVE A WINNER!<br />
* miniprep party, D1/2/3/4<br />
* digestions didn't work too well mmmm going to sequence D1 and D4.<br />
* wbbL good plate, now incubating in shaker<br />
* cgctattcgcgctacctttg ready to order (middle sequencing of HPI/katG)<br />
==6/13 gloves, zymo, and ethanol oh my==<br />
* a random day<br />
# neuS digest used to transform n plate new colonies, since the old plate had only 3 people, and 1 which worked<br />
# wbbL digest > new plate as well (old one had one colony and it was bad)<br />
# yfbE put into shakey tubes<br />
* One of the neuS got miniprepped and the test digest looks good compared to test in ApE<br />
[[Image:061307_ayu_gel1.jpg|100px|right]]<br><br />
# sending it for sequencing, eh.<br />
* Sequencing...<br />
# Most (A1, A4, B1) sucked<br />
# only A3 (HPI/katG) was decent. It might have an addition mutation of a G.<br />
# A3 sent for reverse sequencing with G01001<br />
* Began redo-ing of HPI/katG-making, with a phase 1 PCR (the halves with a mutation)<br />
<br><br />
''Todo'': Input parts in registry (yfbE?)<br />
<br />
==6/12 a bag full of grapes==<br />
* YAY WE ALL GOT OUR OWN SET OF PIPETTE PEOPLE<br />
* PCR of yfbE...<br />
# last night's thing, left in the freezer overnight. >FAIL<<br />
# Did a new PCR -- looks good -- cells xform'd, plate is incubating.<br />
* neuS new xformation looks good. Three colonies now incubating.<br />
* wbbL (1) and HPI/katG (4)<br />
# miniprepped and digest gel ran:<br />
[[Image:061207_ayu_gel1.jpg|100px|right]]<br><br />
# HPI/katG 1,2,3,4 || wbbL || marker<br />
# 1,2 might be okay.. that faint band is weird. 3 is great! 4 = wtf. wbbL = wtf too (should have two bands)<br />
# decision to put 1,3,4,wbbL for sequencing.<br />
[[User:Ayu|Ayu]] 17:59, 12 June 2007 (EDT)<br />
<br />
==6/11 austin's birthday==<br />
* CAKE PARTY - great custard cake<br />
* I put the wbbL (1) and HPI/katG (4) colonies to incubate in LB broth.<br />
* neuS failed; no colonies :(((((((<br />
** redid ligation and xformation. hopefully there will be good results tmrw!<br />
* made like 20 LB-Agar/Amp plates - looks like our stock will last at least this week<br />
* researched nitric oxide (NO) and E. Coli - looks like soxRS is promising<br />
* also researched RBCs and how they deal with NO<br />
* plopped yfbE into PCR will do stuff with it tmrw<br />
<br><br />
''TO DO'': enter yfbE into the registry <br><br />
[[User:Ayu|Ayu]] 18:24, 11 June 2007 (EDT)<br />
<br />
==6/8 long day?==<br />
* My PCR from last night (HPI/katG) was ROXOR! (left)<br />
** xformed some DH10B's. w00t w00t<br />
* Today's PCR was wbbL and neuS. ALSO ROXOR LOL (right)<br />
** xformed DH10B's.<br />
* made oligos for yfbE promoter thingy - will test with GFP and yeah! next week!<br />
* poured lotsa LB/agar+amp plates<br />
<br><br />
[[Image:060807_ayu_gel1.jpg|100px|left]] [[Image:060807_ayu_gel2.jpg|100px|right]]<br />
<br />
==6/7 we got benches==<br />
* we got benches<br />
* pcr of [http://partsregistry.org/Part:BBa_I716253:Design HPI/katG from Salmonella]<br />
# well... getting the mutated PCR prod overnight. going to xform tmrw, hope it works!<br />
* programmed pcr on machine upstairs (#6)<br />
* we got computers<br />
* AGAR SUX, for future reference:<br />
# nuke @ 20:00 min, 50% power.<br />
# water bath in tap water for 5-10 min<br />
# thaw the antibiotic right now!!<br />
# FIRE for disinfecting<br />
# pour that stuff. set 15 min, then marker it then bag<br />
<br />
==6/6 waiting for oligos==<br />
* Made oligos and constructs with Vai, for getting wbbL and neuS from pJ23006-Bca9106<br />
* We tried the P_tet/RFP triple/double digest to make a composite part.<br />
# FAIL<br />
# probably source DNA is bad<br />
# so much for that activity...<br />
<br><br />
''Other stuff'': I won speed scrabble. even though I kind of cheated ish (didn't stop when Sam said stop"<br />
<br />
==6/5 coolbeans==<br />
* Finalized oligos to order with Vai<br />
* Learned about LB broth-ing and LB/Agar plating. Thanks, Austin and Sam :)<br />
* Learned about the many composite part-making methods. Props 2 Chris<br />
# prefix/suffix is weaksauce<br />
# Use the AlwnI or BsaI or BglI, in conjuction with BglII or BamHI << (Did this today)<br />
# DBBS<br />
# 3 antibiotic; MIT endorses, used for BioBrick 1.0. Triple digest = bad<br />
# 1-2-3 method << 'Our Goal' in a few weeks. should be leet.<br />
* Planned and vicariously did the making of '''P_tet+RFP''' brick (see [[Vaibhavi_Umesh_Notebook | Vai Notebook]])<br />
<br><br />
''Other Notes:'' All oligos are being ordered, w00t w00t.<br />
[[User:Ayu|Ayu]] 18:36, 5 June 2007 (EDT)<br />
<br><br />
==6/4 Training Finishes, Real Stuff Starts==<br />
* Incubated some colonies<br />
* Miniprep'd already-been-incubated colonies (2)<br />
* Double digest of the 2 minipreps + parent plasmid<br />
* Colony PCR'd the incubated E.coli<br />
* Ran gel of the digest + PCR<br />
[[Image:060407gelayu.jpg|200px|right]]<br />
* >>> PCR product / Miniprep 1 / Parent Plasmid / Miniprep 2 / Ladder >>><br />
* No bands for PCR or parent. Confused? Other ones look great.<br />
<br><br />
''As for me:'' Wiki acc works now.<br> Designing oligos and will compare with Vai.<br />
[[User:Ayu|Ayu]] 18:19, 4 June 2007 (EDT)<br />
=== ===<br />
<span style='font-family:"Courier New";color:#3366FF;font-size:6.0pt'><br />
to do<br />
</span></div>Ayuhttp://2007.igem.org/wiki/index.php/File:072607_gel1.jpgFile:072607 gel1.jpg2007-07-26T23:10:14Z<p>Ayu: </p>
<hr />
<div></div>Ayu