http://2007.igem.org/wiki/index.php?title=Special:Contributions&feed=atom&limit=250&target=MaRui2007.igem.org - User contributions [en]2024-03-29T09:28:00ZFrom 2007.igem.orgMediaWiki 1.16.5http://2007.igem.org/wiki/index.php/USTCUSTC2011-03-08T10:51:50Z<p>MaRui: </p>
<hr />
<div>__NOTOC__<br />
<br />
[[Image:USTC_Logo.png|512px]]<br />
<br />
<!-- <font color="red"><br />
There are'''<html><script language="JAVASCRIPT"><!-- update your browser, silly--><br />
Today = new Date();<br />
Jamboree = new Date("November 3, 2007");<br />
msInADay = 1000 * 60 * 60 * 24;<br />
display = Math.floor((Jamboree.getTime() - Today.getTime())/msInADay);<br />
document.write(" " + display +" ");<br />
// </script></html>'''days left until the Jamboree!<br />
</font> --><br />
----<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=400px style="padding: 5px" |<br />
=== Our Project:<BR>Extensible Logic Circuit in Bacteria ===<br />
<br />
Artificial Bio-Logic Circuit is composed of "logic gates" and "wires" like Digital Electronic Circuits. Though we have been enjoying the advantages of ultra-large-scale electronic circuits in modern life, we still cannot implement a somewhat small-scale circuit <i>in vivo</i> with several levels of gates.<br />
<br />
Our project is to provide a new method for building up a fully extensible bio-logic circuit in bacteria. A small fragment of DNA containing cis-acting elements, favored for its small scale and potential to implement complex logic computation <i>in vivo</i>, can be systematically built up and act as a gate. Meanwhile, artificial repressors with highly-specific DNA-recognition regions are able to transmit signals without mutual interference, just as enameled wires. In this way, a circuit can be constructed regardless of the number of logic gates and the layout of the wires.<br />
<br />
A demonstration system has also been assembled to show the practicality of this method. Just like Digital Electronic Circuits in early days, it is simple and ugly. Nevertheless, how will it appear in future?<br />
<br />
<font color="#AAAAAA">''For detailed description, please click each hyperlink below.''</font><br />
<br />
|width=330px style="padding: 5px" |<br />
<br />
[[Image:DSCN1243.png|330px]]<br />
<br />
<font color="#AAAAAA">''From left to right''</font><BR><br />
<font color="#AAAAAA">''Back row:''</font> [[USTC/ZhaoYun|Zhao Yun]], [[USTC/LiuZiqing|Liu ZQ]], [[USTC/MaXiaoyu|Ma XY]]<BR><br />
<font color="#AAAAAA">''Front row:''</font> [[USTC/MaRui|Ma Rui]], [[USTC/SuXiaofeng|Su XF]], [[USTC/DingBo|Ding Bo]], [[USTC/ZhanJian|Zhan Jian]]<br />
<br />
<BR clear="both"><br />
<center><html><br />
<script type="text/javascript"><br />
function cantload() {<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = null;<br />
img.src = "http://www2.clustrmaps.com/images/clustrmaps-back-soon.jpg";<br />
document.getElementById("clustrMapsLink").href = "http://www2.clustrmaps.com";<br />
}<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = cantload;<br />
</script><br />
</html></center><br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccccff" |<br />
<br />
<h3>Project</h3><br />
<br />
<br />
[[USTC/Introduction|Introduction]]<br />
<br />
<br />
'''Core Logic Components:'''<br />
<br />
[[USTC/Logic-Gate_Promoters|Logic-Gate Promoters]]<br />
<br />
<br />
'''Wires without Interference:'''<br />
<br />
[[USTC/Repressor_Evolution_on_Plates|Repressor Evolution on Plates]]<br />
<br />
[[USTC/Repressor_Evolution_in_Silico|Repressor Evolution <i>in Silico</i>]]<br />
<br />
<br />
'''Peripheral Devices:'''<br />
<br />
[[USTC/Inputs_and_Outputs|Inputs and Outputs]]<br />
<br />
<br />
'''Extensible System:'''<br />
<br />
[[USTC/Demonstration|A Demonstration]]<br />
<br />
[[USTC/Further_More|Further More]]<br />
<br />
<br />
|width=240px style="padding: 5px; background-color: #ccff99" |<br />
<br />
<h3>Members</h3><br />
<center><br />
<br />
<br />
'''4 Graduates:'''<BR><br />
[[USTC/ZhanJian|Zhan Jian]]<BR><br />
[[USTC/MaRui|Ma Rui]]<BR><br />
[[USTC/DingBo|Ding Bo]]<BR><br />
[[USTC/MaXiaoyu|Ma Xiaoyu]]<BR><br />
<br />
<br />
<br />
'''3 Undergraduates:'''<BR><br />
[[USTC/SuXiaofeng|Su Xiaofeng]]<BR><br />
[[USTC/LiuZiqing|Liu Ziqing]]<BR><br />
[[USTC/ZhaoYun|Zhao Yun]]<br />
<br />
<br />
<br />
'''3 Faculty Advisors:'''<BR><br />
Prof. HY Liu<BR><br />
Prof. JR Wu<BR><br />
Prof. ZH Hou<br />
</center><br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99" |<br />
<br />
<h3>Snapshot</h3><br />
<br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC '''<font color="#bb0000">247</font> Part Sequences''']<br />
<br />
'''<font color="#bb0000">123</font> Parts Submitted'''<br />
<br />
<br />
'''77''' Synthesized Promoters<br />
<br />
'''11''' Novel Artificial Repressors<br />
<br />
<br />
'''~ 350''' New Strains<br />
<br />
'''~ 130''' DNA Strands Sequenced<br />
<br />
'''> 5000''' Colonies Screened<br />
<br />
'''~ 400''' Quantitative Assays<br />
<br />
<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
[[USTC/Events|'''Previous Events''']]<br />
<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccff99"|<br />
<br />
<h3>Resources</h3><br />
<br />
[[USTC/ModelingUtilities|Modeling Utilities]]<br />
<br />
[[USTC/Protocols|Protocols]]<br />
<br />
[[USTC/Sponsors|Sponsors]]<br />
<br />
[[USTC/ServiceProviders|Service Providers]]<br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99"|<br />
<br />
<h3>Gallery</h3><br />
<br />
[[USTC/Photos|Team Photos]]<br />
<br />
[[USTC/LabPhotos|Laboratory]]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:USTCPhotos USTC Photos]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:HuangshanPhotos Huangshan Mountain]<br />
<br />
|width=240px style="padding: 5px; background-color: #ccccff"|<br />
<br />
<h3>Links</h3><br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC Parts Made by USTC iGEM 2007]<br />
<br />
[http://partsregistry.org iGEM Standard Parts' Catalog ]<br />
<br />
[[IGEM2007 Team List]]<br />
<br />
[http://www.ustc.edu.cn Univ. of Sci. and Tech. of China ]<br />
<br />
|}<br />
<br />
----</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T06:43:08Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be strong. Now it is clear that asymmetric O24 can be bound to both by R2 and R4, but neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. We can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T06:32:57Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be strong. Now it is clear that asymmetric O24 can be bound to both by R2 and R4, but neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T06:07:39Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be strong. It is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T06:05:41Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be that strong. It is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T05:58:58Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/DualRepressedOperatorUSTC/DualRepressedOperator2007-10-27T05:15:19Z<p>MaRui: </p>
<hr />
<div>{|<br />
| [[Image:USTC_DualRepressedOperator.png|thumb|512px|'''Figure 1''' Sketch map of Dual-Repressed Operator.]]<br />
| [[Image:USTC_BestNOR.png|thumb|256px|'''Figure 2''' Best NOR, an example of Dual-Repressed Operators.]]<br />
|}<br />
<br />
<br />
As shown in Figure 1 and 2, there may be two or more kinds of repressors that can both bind on one kind of operator tightly. A promoter with this so-called "Dual-Repressed Operator" in the downstream can be used as a well-performing NOR gate. However, we faced a dilemma when integrating these dual-repressed NOR Gates into an actual system. It was because that most of the components in the system require wires exempt from interference while these NOR gates just in the contrary manner take the advantage of the mentioned interference. Therefore, the Dual-Repressed Operator should be carefully selected from the Repression Matrix (Figure 3). ([https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Repression_Matrix more details about this Matrix])<br />
<br />
Remark: that best NOR above contains operator O11, which can be repressed by more than 3 kinds of repressors. It is just like the "Wired OR" in electronics, see also the logic abstract in the right of Figure 1.<br />
<br />
<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|450px|'''Figure 3''' Repression Matrix]]<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/DualRepressedOperatorUSTC/DualRepressedOperator2007-10-27T05:13:55Z<p>MaRui: </p>
<hr />
<div>{|<br />
| [[Image:USTC_DualRepressedOperator.png|thumb|512px|'''Figure 1''' Sketch map of Dual-Repressed Operator.]]<br />
| [[Image:USTC_BestNOR.png|thumb|256px|'''Figure 2''' Best NOR, an example of Dual-Repressed Operators.]]<br />
|}<br />
<br />
<br />
As shown in Figure 1 and 2, there may be two or more kinds of repressors that can both bind on one kind of operator tightly. A promoter with this so-called "Dual-Repressed Operator" in the downstream can be used as a well-performing NOR gate. However, we faced a dilemma when integrating these dual-repressed NOR Gates into an actual system. It was because that most of the components in the system require wires exempt from interference while these NOR gates just in the contrary manner take the advantage of the mentioned interference. Therefore, the Dual-Repressed Operator should be carefully selected from the Repression Matrix (Figure 3). ([https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Repression_Matrix more details about this Matrix])<br />
<br />
Remark: that best NOR above contains operator O11, which can be repressed by more than 3 kinds of repressors. It is just like the "wire OR" in electronics, see also the Logic Abstract in the right of Figure 1.<br />
<br />
<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|450px|'''Figure 3''' Repression Matrix]]<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/DualRepressedOperatorUSTC/DualRepressedOperator2007-10-27T05:12:55Z<p>MaRui: </p>
<hr />
<div>{|<br />
| [[Image:USTC_DualRepressedOperator.png|thumb|512px|'''Figure 1''' Sketch map of Dual-Repressed Operator.]]<br />
| [[Image:USTC_BestNOR.png|thumb|256px|'''Figure 2''' Best NOR, an example of Dual-Repressed Operators.]]<br />
|}<br />
<br />
<br />
As shown in Figure 1 and 2, there may be two or more kinds of repressors that can both bind on one kind of operator tightly. A promoter with this so-called "Dual-Repressed Operator" in the downstream can be used as a well-performing NOR gate. However, we faced a dilemma when integrating these dual-repressed NOR Gates into an actual system. It was because that most of the components in the system require wires exempt from interference while these NOR gates just in the contrary manner take the advantage of the mentioned interference. Therefore, the Dual-Repressed Operator should be carefully selected from the Repression Matrix (Figure 3). ([https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Repression_Matrix more details about this Matrix])<br />
<br />
Remark: that best NOR above contains operator O11, which can be repressed by more than 3 kinds of repressors. It is just like the "wire OR" in electronics, refer to the Logic Abstract in the right of Figure 1.<br />
<br />
<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|450px|'''Figure 3''' Repression Matrix]]<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:57:54Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:55:55Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:54:07Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole heterodimer R2~R4 can bind on O24 as tight as R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:51:27Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:49:21Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
<br />
Furthermore, the dimerization region of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 bind on the right half as well.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:44:46Z<p>MaRui: /* Hybrid Operators for Heterodimeric Repressor */</p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
Furthermore, the dimerization region of our artificial repressors are same, so they can combine into the heterodimeric form, for example, heterodimer R2.R4, one side of R2 can bind to O24's left-half strand while the other side of R4 bind on the right half as well.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T04:42:24Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well, then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44. <br />
Furthermore<br />
<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T04:31:37Z<p>MaRui: </p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair especially for NAND gate, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50% (Ox6).<br />
<br />
<br />
----<br />
== Further Further More ==<br />
<br />
We've shown the fully extensibility of our systematic method for designing and testing artificial gates and wires. More logic gates together with more anti-interference wires always have the potential to compose more complex circuits in larger scales. Sixty years ago, the first transistor was invented, then after about ten years the first integrated circuit was invented. The quality of human life has continually been experiencing great advances. What will the artificial computation in biological organisms probably be like after 20 years? Time will tell.<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T04:28:45Z<p>MaRui: /* Further Further More */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair especially for NAND gate, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
----<br />
== Further Further More ==<br />
<br />
We've shown the fully extensibility of our systematic method for designing and testing artificial gates and wires. More logic gates together with more anti-interference wires always have the potential to compose more complex circuits in larger scales. Sixty years ago, the first transistor was invented, then after about ten years the first integrated circuit was invented. The quality of human life has continually been experiencing great advances. What will the artificial computation in biological organisms probably be like after 20 years? Time will tell.<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T04:26:59Z<p>MaRui: /* Further Further More */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair especially for NAND gate, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
----<br />
== Further Further More ==<br />
<br />
We've shown the fully extensibility of our systematic method for designing and testing artificial gates and wires. More logic gates together with more anti-interference wires always have the potential to compose more complex circuits in larger scales. Sixty years ago, the first transistor was invented. Less than fifty years ago, the first integrated circuit was invented. The quality of human life has continually been experiencing great advances. What will the artificial computation in biological organisms probably be like after 20 years? Time will tell.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/EventsUSTC/Events2007-10-27T04:24:35Z<p>MaRui: </p>
<hr />
<div>[[USTC|Back to Mainpage]]<br />
<br />
''Sorry, there are not enough hands to write the diary.''<br />
<br />
<br />
'''The last day'''<br><br />
Ma Rui is in Shanghai enjoying the convenience of Remote Cooperative Office on the Internet, but suddenly that district (the kernel area of Shanghai) lose its power supply and his documents would not be uploaded to our Wiki. What an unusual accident!<br />
<br />
<br />
'''25/10/2007'''<br><br />
Hard documenting ......<br />
<br />
'''18/09/2007'''<br><br />
[[USTC/JamboreeSchedule|Draft of our schedule for the Jamboree]].<br />
<br />
'''04/09/2007'''<br><br />
The second scheme of NAND gate has been built up and the rough data show that it works.<br />
More precise quantitative data is to be measured.<br />
<br />
'''02/09/2007'''<br><br />
Double-reporters system version 2 has passed sequencing, and been confirmed by X-gal assay<br />
and fluorescence observation.<br />
<br />
'''25/08/2007'''<br><br />
The fluorescent reporter (GFP-aav) in double-reporters system does not work. This fact was confirmed by Ma Rui using several times of fluorescence assays. New version is under construction for next step of NAND gate, and these days Ma Rui have to use classical ONPG method to determine data for designing NOR gate. <br />
<br />
'''22/08/2007'''<br><br />
Most members of the co-repression promoter family show that they can be repressed by either designed repressor. This result shows that NOR and NOT gates have been got, but no one is suitable for NAND gate. We are considering to modify our scheme to search NAND gate. <br />
<br />
'''11/08/2007'''<br><br />
Double-reporters system:<br />
<br />
The E.Coli cultured from the blue colony shows only very weak green fluoresce intensity. We are considering applying some high copy-number plasmid where the double genes are held.<br />
<br />
'''01/08/2007'''<br><br />
There is a mistake in my preparing X-Gal solution. Please rework your correlative experiments. Sorry! (by Ma Rui)<br />
<br />
'''30/07/2007'''<br><br />
First designed repressors. Good job, Bo and Xiaofeng!<br />
<br />
'''22/06/2007'''<br><br />
Struggling for the final-examinations!<br />
<br />
'''16/06/2007'''<br><br />
[https://2007.igem.org/Image:USTC_Tianjin_TTT.jpg Tianjin TTT workshop]<br />
<br />
'''01/06/2007'''<br><br />
Primary experiments begin around this day.<br />
<br />
'''30/05/2007'''<br><br />
Finally fix on the project: Biologic Logic Gates.<br />
<br />
'''16/04/2007'''<br><br />
[https://2007.igem.org/Image:USTC_Chinaworkshopphoto046.jpg Tianjin Synthetic Biology and iGEM Workshop]<br />
<br />
'''25/02/2007'''<br><br />
The New Semester Begins !</div>MaRuihttp://2007.igem.org/wiki/index.php/USTCUSTC2007-10-27T04:13:46Z<p>MaRui: </p>
<hr />
<div>__NOTOC__<br />
<br />
[[Image:USTC_Logo.png|512px]]<br />
<br />
<!-- <font color="red"><br />
There are'''<html><script language="JAVASCRIPT"><!-- update your browser, silly--><br />
Today = new Date();<br />
Jamboree = new Date("November 3, 2007");<br />
msInADay = 1000 * 60 * 60 * 24;<br />
display = Math.floor((Jamboree.getTime() - Today.getTime())/msInADay);<br />
document.write(" " + display +" ");<br />
// </script></html>'''days left until the Jamboree!<br />
</font> --><br />
----<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=400px style="padding: 5px" |<br />
=== Our Project:<BR>Extensible Logic Circuit in Bacteria ===<br />
<br />
Artificial Bio-Logic Circuit is composed of "logic gates" and "wires" like Digital Electronic Circuits. Though we have been enjoying the advantages of ultra-large-scale electronic circuits in modern life, we still cannot implement a somewhat small-scale circuit <i>in vivo</i> with several levels of gates.<br />
<br />
Our project is to provide a new method for building up a fully extensible bio-logic circuit in bacteria. A small fragment of DNA containing cis-acting elements, favored for its small scale and potential to implement complex logic computation <i>in vivo</i>, can be systematically built up and act as a gate. Meanwhile, artificial repressors with highly-specific DNA-recognition regions are able to transmit signals without mutual interference, just as enameled wires. In this way, a circuit can be constructed regardless of the number of logic gates and the layout of the wires.<br />
<br />
A demonstration system has also been assembled to show the practicality of this method. Just like Digital Electronic Circuits in early days, it is simple and ugly. Nevertheless, how will it appear in future?<br />
<br />
<font color="#AAAAAA">''For detailed description, please click each hyperlink below.''</font><br />
<br />
|width=330px style="padding: 5px" |<br />
<br />
[[Image:DSCN1243.png|330px]]<br />
<br />
<font color="#AAAAAA">''From left to right''</font><BR><br />
<font color="#AAAAAA">''Back row:''</font> [[USTC/ZhaoYun|Zhao Yun]], [[USTC/LiuZiqing|Liu ZQ]], [[USTC/MaXiaoyu|Ma XY]]<BR><br />
<font color="#AAAAAA">''Front row:''</font> [[USTC/MaRui|Ma Rui]], [[USTC/SuXiaofeng|Su XF]], [[USTC/DingBo|Ding Bo]], [[USTC/ZhanJian|Zhan Jian]]<br />
<br />
<BR clear="both"><br />
<center><html><br />
<script type="text/javascript"><br />
function cantload() {<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = null;<br />
img.src = "http://www2.clustrmaps.com/images/clustrmaps-back-soon.jpg";<br />
document.getElementById("clustrMapsLink").href = "http://www2.clustrmaps.com";<br />
}<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = cantload;<br />
</script><br />
</html></center><br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccccff" |<br />
<br />
<h3>Project</h3><br />
<br />
<br />
[[USTC/Introduction|Introduction]]<br />
<br />
<br />
'''Core Logic Components:'''<br />
<br />
[[USTC/Logic-Gate_Promoters|Logic-Gate Promoters]]<br />
<br />
<br />
'''Wires without Interference:'''<br />
<br />
[[USTC/Repressor_Evolution_on_Plates|Repressor Evolution on Plates]]<br />
<br />
[[USTC/Repressor_Evolution_in_Silico|Repressor Evolution <i>in Silico</i>]]<br />
<br />
<br />
'''Peripheral Devices:'''<br />
<br />
[[USTC/Inputs_and_Outputs|Inputs and Outputs]]<br />
<br />
<br />
'''Extensible System:'''<br />
<br />
[[USTC/Demonstration|A Demonstration]]<br />
<br />
[[USTC/Further_More|Further More]]<br />
<br />
<br />
|width=240px style="padding: 5px; background-color: #ccff99" |<br />
<br />
<h3>Members</h3><br />
<center><br />
<br />
<br />
'''4 Graduates:'''<BR><br />
[[USTC/ZhanJian|Zhan Jian]]<BR><br />
[[USTC/MaRui|Ma Rui]]<BR><br />
[[USTC/DingBo|Ding Bo]]<BR><br />
[[USTC/MaXiaoyu|Ma Xiaoyu]]<BR><br />
<br />
<br />
<br />
'''3 Undergraduates:'''<BR><br />
[[USTC/SuXiaofeng|Su Xiaofeng]]<BR><br />
[[USTC/LiuZiqing|Liu Ziqing]]<BR><br />
[[USTC/ZhaoYun|Zhao Yun]]<br />
<br />
<br />
<br />
'''3 Faculty Advisors:'''<BR><br />
Prof. HY Liu<BR><br />
Prof. JR Wu<BR><br />
Prof. ZH Hou<br />
</center><br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99" |<br />
<br />
<h3>Snapshot</h3><br />
<br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC '''<font color="#bb0000">247</font> Part Sequences''']<br />
<br />
'''<font color="#bb0000">123</font> Parts Submitted'''<br />
<br />
<br />
'''77''' Synthesized Promoters<br />
<br />
'''11''' Novel Artificial Repressors<br />
<br />
<br />
'''~ 350''' New Strains<br />
<br />
'''~ 130''' DNA Strands Sequenced<br />
<br />
'''> 5000''' Colonies Screened<br />
<br />
'''~ 400''' Quantitative Assays<br />
<br />
<br />
<br />
<br />
<br><br />
<br><br />
<br><br />
[[USTC/Events|'''Previous Events''']]<br />
<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccff99"|<br />
<br />
<h3>Resources</h3><br />
<br />
[[USTC/ModelingUtilities|Modeling Utilities]]<br />
<br />
[[USTC/Protocols|Protocols]]<br />
<br />
[[USTC/Sponsors|Sponsors]]<br />
<br />
[[USTC/ServiceProviders|Service Providers]]<br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99"|<br />
<br />
<h3>Gallery</h3><br />
<br />
[[USTC/Photos|Team Photos]]<br />
<br />
[[USTC/LabPhotos|Laboratory]]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:USTCPhotos USTC Photos]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:HuangshanPhotos Huangshan Mountain]<br />
<br />
|width=240px style="padding: 5px; background-color: #ccccff"|<br />
<br />
<h3>Links</h3><br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC Parts Made by USTC iGEM 2007]<br />
<br />
[http://partsregistry.org iGEM Standard Parts' Catalog ]<br />
<br />
[[IGEM2007 Team List]]<br />
<br />
[http://www.ustc.edu.cn Univ. of Sci. and Tech. of China ]<br />
<br />
|}<br />
<br />
----</div>MaRuihttp://2007.igem.org/wiki/index.php/USTCUSTC2007-10-27T04:13:07Z<p>MaRui: </p>
<hr />
<div>__NOTOC__<br />
<br />
[[Image:USTC_Logo.png|512px]]<br />
<br />
<!-- <font color="red"><br />
There are'''<html><script language="JAVASCRIPT"><!-- update your browser, silly--><br />
Today = new Date();<br />
Jamboree = new Date("November 3, 2007");<br />
msInADay = 1000 * 60 * 60 * 24;<br />
display = Math.floor((Jamboree.getTime() - Today.getTime())/msInADay);<br />
document.write(" " + display +" ");<br />
// </script></html>'''days left until the Jamboree!<br />
</font> --><br />
----<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=400px style="padding: 5px" |<br />
=== Our Project:<BR>Extensible Logic Circuit in Bacteria ===<br />
<br />
Artificial Bio-Logic Circuit is composed of "logic gates" and "wires" like Digital Electronic Circuits. Though we have been enjoying the advantages of ultra-large-scale electronic circuits in modern life, we still cannot implement a somewhat small-scale circuit <i>in vivo</i> with several levels of gates.<br />
<br />
Our project is to provide a new method for building up a fully extensible bio-logic circuit in bacteria. A small fragment of DNA containing cis-acting elements, favored for its small scale and potential to implement complex logic computation <i>in vivo</i>, can be systematically built up and act as a gate. Meanwhile, artificial repressors with highly-specific DNA-recognition regions are able to transmit signals without mutual interference, just as enameled wires. In this way, a circuit can be constructed regardless of the number of logic gates and the layout of the wires.<br />
<br />
A demonstration system has also been assembled to show the practicality of this method. Just like Digital Electronic Circuits in early days, it is simple and ugly. Nevertheless, how will it appear in future?<br />
<br />
<font color="#AAAAAA">''For detailed description, please click each hyperlink below.''</font><br />
<br />
|width=330px style="padding: 5px" |<br />
<br />
[[Image:DSCN1243.png|330px]]<br />
<br />
<font color="#AAAAAA">''From left to right''</font><BR><br />
<font color="#AAAAAA">''Back row:''</font> [[USTC/ZhaoYun|Zhao Yun]], [[USTC/LiuZiqing|Liu ZQ]], [[USTC/MaXiaoyu|Ma XY]]<BR><br />
<font color="#AAAAAA">''Front row:''</font> [[USTC/MaRui|Ma Rui]], [[USTC/SuXiaofeng|Su XF]], [[USTC/DingBo|Ding Bo]], [[USTC/ZhanJian|Zhan Jian]]<br />
<br />
<BR clear="both"><br />
<center><html><br />
<script type="text/javascript"><br />
function cantload() {<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = null;<br />
img.src = "http://www2.clustrmaps.com/images/clustrmaps-back-soon.jpg";<br />
document.getElementById("clustrMapsLink").href = "http://www2.clustrmaps.com";<br />
}<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = cantload;<br />
</script><br />
</html></center><br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccccff" |<br />
<br />
<h3>Project</h3><br />
<br />
<br />
[[USTC/Introduction|Introduction]]<br />
<br />
<br />
'''Core Logic Components:'''<br />
<br />
[[USTC/Logic-Gate_Promoters|Logic-Gate Promoters]]<br />
<br />
<br />
'''Wires without Interference:'''<br />
<br />
[[USTC/Repressor_Evolution_on_Plates|Repressor Evolution on Plates]]<br />
<br />
[[USTC/Repressor_Evolution_in_Silico|Repressor Evolution <i>in Silico</i>]]<br />
<br />
<br />
'''Peripheral Devices:'''<br />
<br />
[[USTC/Inputs_and_Outputs|Inputs and Outputs]]<br />
<br />
<br />
'''Extensible System:'''<br />
<br />
[[USTC/Demonstration|A Demonstration]]<br />
<br />
[[USTC/Further_More|Further More]]<br />
<br />
<br />
|width=240px style="padding: 5px; background-color: #ccff99" |<br />
<br />
<h3>Members</h3><br />
<center><br />
<br />
<br />
'''4 Graduates:'''<BR><br />
[[USTC/ZhanJian|Zhan Jian]]<BR><br />
[[USTC/MaRui|Ma Rui]]<BR><br />
[[USTC/DingBo|Ding Bo]]<BR><br />
[[USTC/MaXiaoyu|Ma Xiaoyu]]<BR><br />
<br />
<br />
<br />
'''3 Undergraduates:'''<BR><br />
[[USTC/SuXiaofeng|Su Xiaofeng]]<BR><br />
[[USTC/LiuZiqing|Liu Ziqing]]<BR><br />
[[USTC/ZhaoYun|Zhao Yun]]<br />
<br />
<br />
<br />
'''3 Faculty Advisors:'''<BR><br />
Prof. HY Liu<BR><br />
Prof. JR Wu<BR><br />
Prof. ZH Hou<br />
</center><br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99" |<br />
<br />
<h3>Snapshot</h3><br />
<br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC '''<font color="#bb0000">247</font> Part Sequences''']<br />
<br />
'''<font color="#bb0000">123</font> Parts Submitted'''<br />
<br />
<br />
'''77''' Synthesized Promoters<br />
<br />
'''11''' Novel Artificial Repressors<br />
<br />
<br />
'''~ 350''' New Strains<br />
<br />
'''~ 130''' DNA Strands Sequenced<br />
<br />
'''> 5000''' Colonies Screened<br />
<br />
'''~ 400''' Quantitative Assays<br />
<br />
<br />
<br />
<br />
<br />
[[USTC/Events|'''Previous Events''']]<br />
<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccff99"|<br />
<br />
<h3>Resources</h3><br />
<br />
[[USTC/ModelingUtilities|Modeling Utilities]]<br />
<br />
[[USTC/Protocols|Protocols]]<br />
<br />
[[USTC/Sponsors|Sponsors]]<br />
<br />
[[USTC/ServiceProviders|Service Providers]]<br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99"|<br />
<br />
<h3>Gallery</h3><br />
<br />
[[USTC/Photos|Team Photos]]<br />
<br />
[[USTC/LabPhotos|Laboratory]]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:USTCPhotos USTC Photos]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:HuangshanPhotos Huangshan Mountain]<br />
<br />
|width=240px style="padding: 5px; background-color: #ccccff"|<br />
<br />
<h3>Links</h3><br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC Parts Made by USTC iGEM 2007]<br />
<br />
[http://partsregistry.org iGEM Standard Parts' Catalog ]<br />
<br />
[[IGEM2007 Team List]]<br />
<br />
[http://www.ustc.edu.cn Univ. of Sci. and Tech. of China ]<br />
<br />
|}<br />
<br />
----</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T03:59:22Z<p>MaRui: </p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair especially for NAND gate, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
----<br />
== Further Further More ==<br />
<br />
We've shown the fully extensibility of our systematic method for designing and testing artificial gates and wires. More logic gates together with more wires always have the potential to compose more complex circuits in larger scales. Sixty years ago, the first transistor was invented. Less than fifty years ago, the first integrated circuit was invented. The quality of human life has continually been experiencing great advances. What will the artificial computation in biological organisms probably be like after 20 years? Time will tell.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T02:05:29Z<p>MaRui: /* Using different Operators */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair especially for NAND gate, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T01:50:33Z<p>MaRui: /* Using different RBS */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for making use of the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T01:45:41Z<p>MaRui: /* Using different Operators */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the specific repressor binding on pattern Ox6 is about half the strength of it on original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T01:42:42Z<p>MaRui: /* Using different Operators */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the pattern Ox6 is about half the strength of original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Repressor_Evolution_on_PlatesUSTC/Repressor Evolution on Plates2007-10-27T01:37:56Z<p>MaRui: </p>
<hr />
<div>== Wires in Bio-logic Circuit ==<br />
<br />
In electronic circuit, metal conductor such as copper is used as wires widely. But in a cell, most of the things are diffusive, so it is a difficult problem to limit a signal in a specific signal channel. High-specific regulator-operator pairs can be used as "copper wires" in bio-logic circuit. It means, repressor or activator transmit a particular signal from the upstream output port to the downstream input port, without interference between each other, like carrier wave in FM radio.<br />
<br />
<br />
=== Why to Design Artificial High-Specific Repressor-Operator Pairs ===<br />
<br />
We have been attempting to construct several artificial high-specific repressor-operator pairs to serve as the connecting wires of our system, based on the knowledge of LacR and its binding site [[USTC/Repressor_Evolution_on_Plates#References|[1, 10]]], and by means of directed evolution and computational protein design. We decide that they should be newly designed for several reasons,<br />
<br />
# The number of natural regulators well studied is moderate [[USTC/Repressor_Evolution_on_Plates#References|[11]]].<br />
# Natural regulators do have some disadvantages. <br />
#* For example, it is well known that there are dozens of downstream regulatory sites of CRP in E.Coli, and if we abuse the CRP, some other natural pathways in the host bacterial will probably be interrupted [[USTC/Repressor_Evolution_on_Plates#References|[2]]]. <br />
#* There may be several unknown sites to be bound with the selected native activators, and we might get unexpected results in such situations. <br />
# This artificial repressor family hold the same property for our cis-acting logic promoters, such as dimerization ad tetramerization [[USTC/Repressor_Evolution_on_Plates#References|[1]]].<br />
<br />
[[Image:USTC_allen1.jpg|thumb|center|500px|'''Figure 1''' Comics: All we need are the specific artificial 'repressor fish' that can definitely bite the specific 'operator hook' exclusively]]<br />
<br />
<br />
== Start: Lac repressor ==<br />
<br />
[[Image:USTC_1l1m_bio_r_500.jpg|thumb|'''Figure 2''' Solution structure of a dimer of Lac repressor DNA-binding domain complexed to its natrual operator O1 ([http://www.rcsb.org/pdb/explore.do?structureId=1L1M From RCSB])]]<br />
<br />
The lac repressor in Lac operon is a well-studied transcriptional factor involved in the metabolism of lactose in bacteria. It has three distinct regions :<br />
<br />
* a headpiece which recognize DNA and joins two monomers to form a dimer at the same time<br />
* a core region which binds allolactose and IPTG<br />
* a tetramerization region which joins four monomers in an alpha-helix bundle)<br />
<br />
The DNA binding region of Lac repressor consists of a helix-turn-helix structural motif and has been well studied as a model structure of transcription factor in helix-turn-helix family[[USTC/Repressor_Evolution_on_Plates#References|[1,3]]].<br />
<br />
<br />
== Selection of operator sequence ==<br />
<br />
By means of bioinformatics we can select a DNA sequence that has never appeared in the genome of E.Coli, and let the regulator bind to the sequence with quite high specificity and high affinity [[USTC/Repressor_Evolution_on_Plates#References|[6]]]. Therefore, we will not have to worry about the regulator’s interrupting the normal functioning of the host genome (A tiny exception: the host strain should not contain <i>lacI</i> and lac promoter, such as [http://openwetware.org/wiki/E._coli_genotypes#TOP10_.28Invitrogen.29 Top10]).<br />
<br />
O11 aattgtgagcgctcacaatt<br />
O22 aattgtaagcgcttacaatt<br />
O33 aattgtaaacgtttacaatt<br />
O44 aattgtgaacgttcacaatt<br />
O55 aattttgagcgctcaaaatt<br />
O66 aattatgagcgctcataatt<br />
O77 gacgactgtatacagtcgtc<br />
<br />
<br />
<br />
<br />
----<br />
== Directed Repressor Evolution ==<br />
<br />
=== Targeted Mutagenesis ===<br />
[[Image:USTC_allen2.jpg|thumb|right|300px|'''Figure 3''' The recognition region of Lac repressor of which the amino acid residues we will try to modify. This figure comes from 'Roberto Kopke Salinas, etc. ''ChemBioChem 2005, 6, 1628 – 1637'']]<br />
<br />
Figure 3 shows the recognition region of which the amino acid residues we will try to modify. With saturation mutagenesis [[USTC/Repressor_Evolution_on_Plates#References|[4, 5]]], it is possible to create a library of mutants containing all possible mutations at these positions. Because the targeted sites are near to the beginning of the <i>lacI</i> gene yet beyond the range of one primer region, two steps of PCR are carried out to generate the random repressor family shown in Figure 4. Then the PCR production is purified and digested, loaded into the repressor-production plasmid to take the repression assay.<br />
<br />
[[Image:USTC_RepressorMutagenesis.png|thumb|left|350px|'''Figure 4''' Random repressor family generation by PCR.]]<br />
<br />
<BR clear="both"><br />
<br />
=== Repression Assay ===<br />
<br />
With the help of pUC-repressor and pZS*-reporter, the two plasmids shown in Figure 5, we will be able to accomplish the repression assay.<br />
<br />
The first plasmid is in charge of repressor production, that is, to express the repressor constitutively. The second plasmid contains two reporter genes, <i>lacZ</i> (alpha fragment) and <i>gfp-AAV</i>, respectively, and an upstream promoter that reflects the repression effect in the form of binding intensity. Once the repression exists, the promoter will lose its activity. Consequently, neither of the downstream lacZ or GFP-AAV reporter gene will work. By reading the blue/white colonies on a plate with naked eyes and the fluorescence intensity of GFP with a fluorescence microscope, we can finally get to know the repression effect, and can ratiocinate from it the binding affinity of the repressor-operator pair.<br />
<br />
[[Image:ustc_repressor_assay.png|thumb|center|600px|'''Figure 5''' (a) Left: Plasmid pUC-repressor, a repressor-production plasmid. Right: Plasmid pZS*-reporter, a repression-reporter plasmid. If the repressor produced by pUC-repressor is able to repress the promoter on pZS*-reporter, neither the activity of beta-galactosidase nor the expression of GFP will be observed. (b) Scheme of the promoter on the pZS*-reporter. There are two repressor binding sites around the RNA polymerase binding site. If the designed repressor is able to bind the designed operator, the activity of the promoter will be repressed.]]<br />
<br />
=== Screening ===<br />
<br />
First, pUC-repressor plasmid containing random repressor family members are transformed into Top10/pZS*-PO_target-lacZa. White colonies, which shows that repressors there can repress the target promoter, are select from Blue/White Screening on top agar Luria-Bertani broth. The repression should be re-tested to eliminate the false positive samples by X-gal assay and PCR checking. The survivals will be quantificationally measured in ONPG assay or fluorescent assay.<br />
<br />
[[Image:USTC_repressor_screening.jpg|thumb|center|600px|'''Figure 6''' (a) One of the Blue/White screening plates. The red-marked colony are a target. (b) One of the plates in the repression assay. The blue or light blue colonies show the repressor expressed in the strains cannot or can weakly binding to the specified operator sequence, and in contrast, the repressor produced in the white colonies can repress the specified promoter. (c) PCR checking for promoter and lacZ alpha fragment.]]<br />
<br />
===Quantitive Assay(Cross Repression Test)===<br />
We selected 7 repressor-promoter pair candidates from Blue/White Screening results above for quantitive assay of specificity and affinity. In addition, 2 existed represor-promoter pairs are added to this work as new candidates. Then, each repressor-expression plasmid is transform to each Top10 competent cell with specific target promoters. Eventually, each expression quantity of LacZ alpha or GFP is measured by ONPG assay(LacZ) or fluorescent assay(GFP).The process are shown as below.<br />
<br />
[[Image:USTC_ crossrepressiontest.jpg|center|600px]]<br />
<br />
<br />
<br />
<br />
----<br />
== Results ==<br />
<br />
The consequent data of reporter's expression is, by formula, converted to the Repression Value(R.V.) representing the repression intensity of each repressor-promoter pair. From the formula below we can see higher value of R.V. represents the higher expression of reporter gene and indicates a lower repression while the reverse represents a high repression. The sets of R.V. is depicted on the scheme below which have been transformed to corresponding Repression Matrix-more visual that the coordinate scheme. And the Orthogonal Repression Matrix birthing from Repression Matrix can be used to acquire specific repressor-promoter pairs with high specificity.<br />
<br />
[[Image:USTC_rv.jpg|500px|center]]<br />
<br />
<br />
<!--<br />
=== Repression Scheme ===<br />
<br />
The directed results are charted on one coordinate scheme.<br />
<br />
[[Image:USTC_RepressionScheme.jpg|thumb|center|550px|'''Figure 7''' This scheme indicates the cross repression test of our repressor and promoter candidates. The vertical axis tell us the Repression Value(R.V.) of each repressor-promoter pairs by plots, in which the higher R.V.shows the higher expression of reporter protein(even exceed the condition without repressors)-the low repression. The horizontal axis represents the different repressors, and the colors represent different promoters]]<br />
--><br />
<br />
=== Repression Matrix ===<br />
<br />
Performances of our wires are shown as so-called "Repression Matrix", an array of R.V. with variant combinations of artificial repressors and operators. A "Repression Matrix" taken from the literature [[USTC/Repressor_Evolution_on_Plates#References|[7,8,9]]] and uniformed is also plotted in [[USTC/RepressionMatrixFromLiterature|this page]].<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|500px|'''Figure 8''' Repression Metrix(RM):The repression matrix reveals the binding affinity of different repressor candidates with various specific promoters by different colors. The deeper the red will be, the higher the repression will appear. While the lighter the blue is the weaker the repression will show.]]<br />
<br />
=== Orthologal Repression Matrix ===<br />
<br />
[[Image:USTC_OrthologalRepressionMatrix.png|thumb|rught|200px|'''Figure 9''' Orthologal Repression Metrix(ORM)-One of the ORM comes from above RM:The red diagonal of this matrix indicates that each target repressor can only firmly bind to its specific target promoter and has weak or even no binding to other operator sequences.]]<br />
<br />
Several 'wires' without interference are selected based on that repressors can only specifically bind to the right promoter without strong repressed interaction with other promoters which have their own special repressors. Thereby, the red color plot in Repression Matrix should be placed on the right site by interchange of columns so that each row and each column in the Matrix can have only one red plot. The other repressor candidate columns which cannot pass muster will be deleted from the RM. Eventually, a 3x3 Orthogonal Repression Matrix for [[USTC/Demonstration|the demonstration system]] shown in Figure 9, which looks like an orthogonal matrix in mathematics, contains single red plot in each column & each row, reflecting the specific repression.<br />
<br />
<br />
<br />
<br />
----<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol 328</i> (6), 521--548.<br />
<br />
2. Lac Operon, http://en.wikipedia.org/wiki/Lac_Operon<br />
<br />
3. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
4. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Methods and Protocols', <i>Methods in Molecular Biology<i>, Humana Press, Volume 231, 2003<br />
<br />
5. Arnold, Frances H. and Georgiou, George. ' Directed Evolution Library Creation, Screening and Selection Methods', <i>Methods in Molecular Biology</i>, Humana Press, Volume 230, 2003<br />
<br />
6. Sadler, J. R.; Sasmor, H. & Betz, J. L. (1983), 'A perfectly symmetric lac operator binds the lac repressor very tightly.', <i>PNAS</i> 80(22), 6785--6789.<br />
<br />
7. Lehming, N.; Sartorius, J.; Niemöller, M.; Genenger, G.; v Wilcken-Bergmann, B. & Müller-Hill, B. (1987), 'The interaction of the recognition helix of lac repressor with lac operator.', <i>EMBO J</i> 6(10), 3145--3153.<br />
<br />
8. Lehming, N.; Sartorius, J.; Oehler, S.; von Wilcken-Bergmann, B. & Müller-Hill, B. Recognition helices of lac and lambda repressor are oriented in opposite directions and recognize similar DNA sequences. <i>PNAS</i>, 1988, 85, 7947-7951<br />
<br />
9. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), 'lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges.', <i>EMBO J</i> 8(4), 1265--1270.<br />
<br />
10. Salinas, R. K.; Folkers, G. E.; Bonvin, A. M. J. J.; Das, D.; Boelens, R. & Kaptein, R. Altered specificity in DNA binding by the lac repressor: a mutant lac headpiece that mimics the gal repressor.' <i>Chembiochem</i>, 2005, 6, 1628-1637<br />
<br />
11. Müller-Hill, B. 'Some repressors of bacterial transcription.' <i>Curr Opin Microbiol</i>, 1998, 1, 145-151</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Further_MoreUSTC/Further More2007-10-27T01:33:37Z<p>MaRui: /* Using different Operators */</p>
<hr />
<div>== Further Optimization ==<br />
<br />
Though the existing bio-logic gates and wires are able to form a practicable combinational logic circuit in a bacterial cell, there remain some bottlenecks limiting the capability of our method. <br />
<br />
* '''Size of the Wires'''<br>The size of wires are much larger than the gates in our system. We think it should be reduced. Some ligands, for example, peptides, saccharides, lipid and so on, might be used as signal carrier.<br />
<br />
* '''More Input Signals'''<br>More signals with high quality are needed in larger-scale bio-logic circuit to serve as inputs. We think computational protein-ligand design can play an important role in providing more highly-specificied protein-ligand pairs.<br />
<br />
* '''Response Time'''<br>At present, the response time of our bio-logic gates is much longer than that of electronic ones. This situation should be improved. <br />
<br />
* '''I/O Standardization'''<br>Intensity of the input and output signals for different gates should be adjusted to the same level. There are several proposals as following.<br />
<br />
<br />
<br />
== Conductance Adjusting ==<br />
<br />
As mentioned above, the non-interference Repressor/Operator pairs can function well as “wires”. Of course, different pairs have different strength of bond. Binding intensity may also be different even if the two components are of the same type. Therefore, these wires will transmit different intensity of signals from upstream components to downstream ones. In qualitative or semiquantitative experiments, this will not be a serious problem, but we must solve it for experiments that are more precise.<br />
<br />
<br />
We all know that different promoters can initiate transcription strongly or weakly ([http://partsregistry.org/Part:BBa_J23100 Parts:BBa_J23100 and its family]). On the other hand, various RBS may lead to various efficiency of translation ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). Naturally, we will think of the following two approaches: using different promoters or using different RBS. However, according to the idea of “modularization”, we don’t want to casually modify promoters because these promoters are the kernel elements of our logic components. Anyway, we can modify other elements around this kernel, i.e. the RBS and operators. Let’s imagine the wires--every wire has two ends, and each of our Repressor/Operator pairs is a monodirectional wire. The beginning end is the RBS that activates the translation of this repressor protein, and the tail end is the operator to which an according repressor can bind. <br />
<br />
<br />
To modify the RBS or operators is just like changing the conductance at the junctions of actual wires, so we call it “Conductance Adjusting”:<br />
<br />
===Using different RBS===<br />
<br />
Registry of Standard Biological Parts have provided many kinds of RBS whose activities varies in a wide range ([http://partsregistry.org/Part:BBa_J61100 Parts:BBa_J61100 and its family] and [http://partsregistry.org/JCA_Arkin_RBSFamilyPart2 JCA_Arkin_RBS Family]). We’ve submitted our repressor protein coding parts without RBS or terminator so that every one can assemble them with appropriate RBS to get any efficiency of translation he wants.<br />
<br />
[[Image:USTC NoRBS.png]]<br />
<br />
<br />
We have also submitted those protein coding parts with RBS B0034 and terminator B0015 assembled. If you care nothing for the difference between different RBS, well, then they are good enough.<br />
<br />
[[Image:USTC WithRBS.png]]<br />
<br />
<br />
===Using different Operators===<br />
<br />
[https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Directed_Repressor_Evolution Directed repressor evolution] has made the repressor/operator pairs bind tighter and tighter when it increase the specificity of these pairs. However, we may not need so strong a bound pair, so it is appropriate to develop a systematic method for weakening this strength. We have [[USTC/OperatorComposition|tried to do this]] and found the pattern Ox6 is about half the strength of original Oxx. Unfortunately Ox6 is not a general pattern because of singular sequence O66; meanwhile the general pattern Ox7 with a random sequence from O77 is too weak for our purpose. ([[https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7]])<br />
We do not settle for only one singular pattern, so the next work may be to design and test more artificial pattern. Our aim is to get a series of pattern with different weakening effect instead of about 50%.<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-27T00:29:11Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by the right half of O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px|'''Figure 1''' The activating intensity of these promoters when corresponding specific repressor exsiting.]]<br />
<br />
<br />
After a series of our experiments (refer to Figure 1 whose data were from fluorescent measurement), we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but we found that it has no special feature compared with O16 according to data. For predigestion, we discard "O6x" series in the next works.<br />
<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-27T00:23:09Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-27T00:19:43Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by the right half of O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px|'''Figure 1''' The activating intensity of these promoters when corresponding specific repressor exsiting.]]<br />
<br />
<br />
After a series of our experiments (refer to Figure 1 whose data were from fluorescent measurement), we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but it has no special feature compared with O16. For predigestion, we discard "O6x" series in the next works.<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-27T00:01:22Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by the right half of O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px|'''Figure 1''' The activating intensity of these promoters when corresponding specific repressor exsiting.]]<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but it has no special feature compared with O16. For predigestion, we discard "O6x" series in the next works.<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T23:44:13Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by the right half of O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px]]<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but it has no special feature compared with O16. For predigestion, we discard "O6x" series in the next works.<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T23:40:18Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are all based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by a random sequence from O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px]]<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but it has no special feature compared with O16. For predigestion, we discard "O6x" series in the next works.<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T18:24:01Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are all based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by a random sequence from O77<br />
* NUL, the positive control as intensity 1.00<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px]]<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up O61, the left half of O11 replaced by the left half of O66, but it has no special features compared with O16.<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T18:12:43Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. Three of them are all based on O11 operator:<br />
<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
* O11, the perfectly symmetric operator in this five ones<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by a random sequence from O77<br />
* NUL, the positive control as intensity 1.00<br />
<br />
([https://2007.igem.org/USTC/HybridOperator#Hybrid_Operators_for_Weaker_Binding more details about Ox6 and Ox7])<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|512px]]<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
Actually, we've made up<br />
<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T18:01:48Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|right]]<br />
<br />
Five promoters have been synthesized for testing the effect of weakening. They are all based on O11 operator:<br />
* O11, the perfectly symmetric operator<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O17, the right half of O11 replaced by a random sequence from O77<br />
* NUL, the positive control as intensity 1.00<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|center|450px]]<br />
<br />
<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T17:56:45Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|right|400px]]<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
Six promoters have been synthesized for testing the effect of weakening. They are all based on O11 operator:<br />
* O11, the perfectly symmetric operator<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by the right half of O66<br />
* O61, the left half of O11 replaced by the left half of O66<br />
* O17, the right half of O11 replaced by a random sequence from O77<br />
* NUL, the positive control as intensity 1.00<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|center]]<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-26T17:51:55Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
==Hybrid Operators for Heterodimeric Repressor==<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
<br />
<br />
==Hybrid Operators for Weaker Binding==<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Get more details about Ox6 and Ox7 on page [[USTC/Further_More|Further More]].)<br />
<br />
<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-26T17:09:21Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).<br />
<br />
Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Get more details about Ox6 and Ox7 on page [[USTC/Further_More|Further More]].)<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-26T17:03:23Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
Biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s). Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Get more details about Ox6 and Ox7 on page [[USTC/Further_More|Further More]].)<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/HybridOperatorUSTC/HybridOperator2007-10-26T17:01:01Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
Biologists always use symmetric operators like O22 because they are the most suitable ones to be bound by their own specific repressor(s). Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22, well then it is clear that asymmetric O24 can be bound to both by R2 and R4. However, neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.<br />
<br />
[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]<br />
<br />
There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound by R4 for our purpose. (Get more details about Ox6 and Ox7 on page [[USTC/Further_More|Further More]].)<br />
<br />
== References ==<br />
<br />
1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/DualRepressedOperatorUSTC/DualRepressedOperator2007-10-26T16:22:17Z<p>MaRui: </p>
<hr />
<div>{|<br />
| [[Image:USTC_DualRepressedOperator.png|thumb|512px|'''Figure 1''' Sketch map of Dual-Repressed Operator.]]<br />
| [[Image:USTC_BestNOR.png|thumb|256px|'''Figure 2''' Best NOR, an example of Dual-Repressed Operators.]]<br />
|}<br />
<br />
<br />
As shown in Figure 1 and 2, there may be two or more kinds of repressors that can both bind on one kind of operator tightly. A promoter with this so-called "Dual-Repressed Operator" in the downstream can be used as a well-performing NOR gate. However, we faced a dilemma when integrating these dual-repressed NOR Gates into an actual system. It was because that most of the components in the system require wires exempt from interference while these NOR gates just in the contrary manner take the advantage of the mentioned interference. Therefore, the Dual-Repressed Operator should be carefully selected from the Repression Matrix (Figure 3). ([https://2007.igem.org/USTC/Repressor_Evolution_on_Plates#Repression_Matrix more details about this Matrix])<br />
<br />
<br />
<br />
[[Image:USTC_RepressionMatrix.png|thumb|center|450px|'''Figure 3''' Repression Matrix]]<br />
<br />
<br />
<br><br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTCUSTC2007-10-26T15:44:31Z<p>MaRui: </p>
<hr />
<div>__NOTOC__<br />
<br />
[[Image:USTC_Logo.png|512px]]<br />
<br />
<!-- <font color="red"><br />
There are'''<html><script language="JAVASCRIPT"><!-- update your browser, silly--><br />
Today = new Date();<br />
Jamboree = new Date("November 3, 2007");<br />
msInADay = 1000 * 60 * 60 * 24;<br />
display = Math.floor((Jamboree.getTime() - Today.getTime())/msInADay);<br />
document.write(" " + display +" ");<br />
// </script></html>'''days left until the Jamboree!<br />
</font> --><br />
----<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=400px style="padding: 5px" |<br />
=== Our Project:<BR>Extensible Logic Circuit in Bacteria ===<br />
<br />
Artificial Bio-Logic Circuit is composed of "logic gates" and "wires" like Digital Electronic Circuits. Though we have been enjoying the advantages of ultra-large-scale electronic circuits in modern life, we still cannot implement a somewhat small-scale circuit in vivo with several levels of gates.<br />
<br />
Our project is to provide a new method for building up a fully extensible bio-logic circuit in bacteria. A small fragment of DNA containing cis-acting elements, favored for its small scale and potential to implement complex logic computation in vivo, can be systematically built up and act as a gate. Meanwhile, artificial repressors with highly-specific DNA-recognition regions are able to transmit signals without mutual interference, just as enameled wires. In this way, a circuit can be constructed regardless of the number of logic gates and the layout of the wires.<br />
<br />
A demonstration system has also been assembled to show the practicality of this method. Just like Digital Electronic Circuits in early days, it is simple and ugly. Nevertheless, how will it appear in future?<br />
<br />
<font color="#AAAAAA">''For detailed description, please click each hyperlink below.''</font><br />
<br />
|width=330px style="padding: 5px" |<br />
<br />
[[Image:DSCN1243.png|330px]]<br />
<br />
<font color="#AAAAAA">''From left to right''</font><BR><br />
<font color="#AAAAAA">''Back row:''</font> [[USTC/ZhaoYun|Zhao Yun]], [[USTC/LiuZiqing|Liu ZQ]], [[USTC/MaXiaoyu|Ma XY]]<BR><br />
<font color="#AAAAAA">''Front row:''</font> [[USTC/MaRui|Ma Rui]], [[USTC/SuXiaofeng|Su XF]], [[USTC/DingBo|Ding Bo]], [[USTC/ZhanJian|Zhan Jian]]<br />
<br />
<BR clear="both"><br />
<center><html><br />
<script type="text/javascript"><br />
function cantload() {<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = null;<br />
img.src = "http://www2.clustrmaps.com/images/clustrmaps-back-soon.jpg";<br />
document.getElementById("clustrMapsLink").href = "http://www2.clustrmaps.com";<br />
}<br />
img = document.getElementById("clustrMapsImg");<br />
img.onerror = cantload;<br />
</script><br />
</html></center><br />
|}<br />
<br />
{| cellspacing="2px" cellpadding="20" border="0" style="padding: 0px; width: 750px<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccccff" |<br />
<br />
<h3>Project</h3><br />
<br />
<br />
[[USTC/Introduction|Introduction]]<br />
<br />
<br />
'''Core Logic Components:'''<br />
<br />
[[USTC/Logic-Gate_Promoters|Logic-Gate Promoters]]<br />
<br />
<br />
'''Wires without Interference:'''<br />
<br />
[[USTC/Repressor_Evolution_on_Plates|Repressor Evolution on Plates]]<br />
<br />
[[USTC/Repressor_Evolution_in_Silico|Repressor Evolution <i>in Silico</i>]]<br />
<br />
<br />
'''Peripheral Devices:'''<br />
<br />
[[USTC/Inputs_and_Outputs|Inputs and Outputs]]<br />
<br />
<br />
'''Extensible System:'''<br />
<br />
[[USTC/Demonstration|A Demonstration]]<br />
<br />
[[USTC/Further_More|Further More]]<br />
<br />
<br />
|width=240px style="padding: 5px; background-color: #ccff99" |<br />
<br />
<h3>Members</h3><br />
<center><br />
<br />
<br />
'''4 Graduates:'''<BR><br />
[[USTC/ZhanJian|Zhan Jian]]<BR><br />
[[USTC/MaRui|Ma Rui]]<BR><br />
[[USTC/DingBo|Ding Bo]]<BR><br />
[[USTC/MaXiaoyu|Ma Xiaoyu]]<BR><br />
<br />
<br />
<br />
'''3 Undergraduates:'''<BR><br />
[[USTC/SuXiaofeng|Su Xiaofeng]]<BR><br />
[[USTC/LiuZiqing|Liu Ziqing]]<BR><br />
[[USTC/ZhaoYun|Zhao Yun]]<br />
<br />
<br />
<br />
'''3 Faculty Advisors:'''<BR><br />
Prof. HY Liu<BR><br />
Prof. JR Wu<BR><br />
Prof. ZH Hou<br />
</center><br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99" |<br />
<br />
<h3>Statistics</h3><br />
<br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC '''<font color="#bb0000">247</font> Part Sequences''']<br />
<br />
'''<font color="#bb0000">123</font> Parts Submitted'''<br />
<br />
<br />
'''77''' Synthesized Promoters<br />
<br />
'''11''' Novel Artificial Repressors<br />
<br />
<br />
'''~ 350''' New Strains<br />
<br />
'''~ 130''' DNA Strands Sequenced<br />
<br />
'''> 5000''' Colonies Screened<br />
<br />
'''~ 400''' Quantitative Assays<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
[[USTC/Events|'''Previous Events''']]<br />
<br />
|-valign="top"<br />
|width=240px style="padding: 5px; background-color: #ccff99"|<br />
<br />
<h3>Resources</h3><br />
<br />
[[USTC/ModelingUtilities|Modeling Utilities]]<br />
<br />
[[USTC/Protocols|Protocols]]<br />
<br />
[[USTC/Sponsors|Sponsors]]<br />
<br />
[[USTC/ServiceProviders|Service Providers]]<br />
<br />
|width=240px style="padding: 5px; background-color: #FFFF99"|<br />
<br />
<h3>Gallery</h3><br />
<br />
[[USTC/Photos|Team Photos]]<br />
<br />
[[USTC/LabPhotos|Laboratory]]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:USTCPhotos USTC Photos]<br />
<br />
[http://sg.ustc.edu.cn/mediawiki/index.php/IGEM_USTC_2007:HuangshanPhotos Huangshan Mountain]<br />
<br />
|width=240px style="padding: 5px; background-color: #ccccff"|<br />
<br />
<h3>Links</h3><br />
<br />
[http://partsregistry.org/cgi/partsdb/pgroup.cgi?pgroup=iGEM2007&group=USTC Parts Made by USTC iGEM 2007]<br />
<br />
[http://partsregistry.org iGEM Standard Parts' Catalog ]<br />
<br />
[[IGEM2007 Team List]]<br />
<br />
[http://www.ustc.edu.cn Univ. of Sci. and Tech. of China ]<br />
<br />
|}<br />
<br />
----</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/OperatorCompositionUSTC/OperatorComposition2007-10-26T15:41:14Z<p>MaRui: </p>
<hr />
<div>[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]<br />
<br />
<br />
<br />
[[Image:USTC_OperatorCompostions.png|thumb|right|400px]]<br />
<br />
Generally, Lac repressor bind to its operator in the form of dimer [[USTC/OperatorComposition#References|[1]]]. Almost all the according operators in nature are of approximate reverse symmetric structure, that is, each half of the operators consists of about 10 nucleotides and receives the binding of a repressor monomer [[USTC/OperatorComposition#References|[2]]]. It has been reported that it is the perfectly symmetric operator that most tightly binds to native Lac repressor. Based on this fact, an idea was proposed that the binding affinity of a non-symmetric operator might be systematically reduced, exempt from the harm on the binding specificity of the repressor-operator pairs.<br />
<br />
Five promoters have been synthesized and tested:<br />
* O11, the perfectly symmetric operator<br />
* O1wt1, the native lac operator at +11 site of Plac promoter<br />
* O16, the right half of O11 replaced by a sequence that weakly binds to Lac repressor, but has the same pattern as O11's.<br />
* O17, the right half of O11 replaced by a random sequence<br />
* NUL, the positive control<br />
<br />
[[Image:USTC_AlignmentOfCompostions.png|frame|center]]<br />
<br />
After a series of experiments, we came to the conclusion that the method of replacing the right half of the symmetric operator can systematically reduce the binding affinity. Ox6, which means the right half of a symmetric operator is replaced by a weak operator sequence with the same pattern, can be used as a "weak" operator. At the same time, we found that the pattern Ox7 is weaker than that of Ox6, and [https://2007.igem.org/USTC/FailureOfNANDv2b the affinity of Ox7 is too low for a logic gate].<br />
<br />
== References ==<br />
<br />
1. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328 (6), 521--548.<br />
<br />
2. John R. Sadler, Henri Sasmor, and Joan L. Betz, A perfectly symmetric lac operator binds the lac repressor very tightly. <i>PNAS</i> Vol. 80, pp. 6785-6789, November 1983</div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Logic-Gate_PromotersUSTC/Logic-Gate Promoters2007-10-26T15:23:11Z<p>MaRui: </p>
<hr />
<div><br />
== Cis-acting Bio-Logic Gates ==<br />
<br />
In natural cells, combinational logic computation can be carried out by cis-acting elements [[USTC/Logic-Gate_Promoters#References|[4]]]. Theoretically, dual repressors interacting on two adjacent operators can generate complex logic function as NAND, NOT and NOT [[USTC/Logic-Gate_Promoters#References|[1,2,3]]]. However, seldom of the parameters of these models has been measured, and practical artificial logic promoters are hard to make because of the lack of appropriate inputs. In this project, we simplify these models to reduce the number of parameters, use artificial high-specific repressors based-on Lac repressor [[USTC/Logic-Gate_Promoters#References|[8]]] to serve as inputs, predict possible patterns of logic promoters, construct and test them experimentally, all to attempt to find a systematical way to construct cis-acting bio-logic promoters. As a result, a piece of DNA about 60 - 200bp is able to be built up and to act as a logic gate.<br />
<br />
=== Advatanges of Cis-acting Bio-Logic Gates ===<br />
# Work in vivo and can be genetically inherited<br />
# Can be systematically built up according to several patterns<br />
# Small in scale<br />
#* About 2.0nm in width, 20 - 70nm in length, similar to transistors in present VSLI in size [[USTC/Logic-Gate_Promoters#References|[12]]], sometimes even smaller<br />
# Can be cascaded to implement any complex combinational logic computation<br />
#* And is also able to form sequential circuit<br />
<br />
<br />
<br />
<br />
== Repression Model ==<br />
<br />
[[Image:USTC_RepressionModel.png|thumb|right|300px|'''Figure 1''' (a) Sketch map of solo-repression. (b) Sketch map of co-repression.]]<br />
<br />
Lacramioara Bintu et al. have reported a simple thermodynamic model which can quantify promoter activity under one or more regulatory factors [[USTC/Logic-Gate_Promoters#References|[1,2]]]. In this project, we focus on the multiple changes of promoter activity under the existence of one or two repressors. For a weak promoter, the multiple of its change can be approximately described as a function of different repressor concentrations, inter-operator distances, repressor–operator affinity and repressor-repressor interactions.<br />
<br />
For a promoter containing a single operator site shown in Figure 1(a), the promoter activity under <i>R</i> repressor molecules <i>A(R)</i> is:<br />
<br />
[[Image:USTC_RepressionModel_FC_Solo.png|center]]<br />
<br />
Note that <i>A(0)</i> is the promoter activity without repression; <i>&rho;(P)</i> is the solo-repression coefficient of the operator at the position <i>P</i>; <i>&Delta;&epsilon;(O)</i> is the difference of binding energy of operator <i>O</i> on specific sites to non-specific sites; <i>N<sub>NS</sub></i> is the number of non-specific sites; and <i>K<sub>B</sub></i> means the Boltzmann constant, <i>T</i> is the temperature.<br />
<br />
For a promoter containing two different operators, of which the relative repressors may be able to interact with each other shown in Figure 1(b), the promoter activity under combinations of two repressors, R<sub>A</sub> and R<sub>B</sub>, is given as:<br />
<br />
[[Image:USTC_RepressionModel_FC_Co.png|center]]<br />
<br />
Where <i>&omega;(P<sub>A</sub>, P<sub>B</sub>)</i> is the co-repression coefficient when O<sub>A</sub> is located at <i>P<sub>A</sub></i>, and O<sub>B</sub> at <i>P<sub>B</sub></i>.<br />
<br />
Concerning a NOT gate which works under approximately equal high or low repressor concentration, R<sub>low</sub>=0 and R<sub>high</sub>=R<sub>H</sub>, we assessed its performance by giving it a score:<br />
<br />
[[Image:USTC_RepressionModel_NOT_Score.png|center]]<br />
<br />
In the same way, NAND score and NOR score are:<br />
<br />
[[Image:USTC_RepressionModel_NAND_Score.png|center]]<br />
<br />
[[Image:USTC_RepressionModel_NOR_Score.png|center]]<br />
<br />
In the situation with a fixed combination of two repressors, R<sub>A</sub> and R<sub>B</sub>, and approximately equal high or low repressor concentration, the logic performance of a promoter is a function of inter-operator distances, repressor–operator affinity and repressor-repressor interactions. By adjusting these parameters, it is possible to find out well-performing bio-logic promoters.<br />
<br />
<br />
<br />
<br />
----<br />
== Schemes of Bio-Logic Promoters ==<br />
<br />
Dozens of potential bio-logic patterns were experimentally synthesized and tested in solo-repression or co-repression test-bench. Some representative ones are shown and commented as following.<br />
<br />
{| border="1"<br />
|-<br />
|align="center"| '''Scheme'''<br />
|align="center"| '''Test-environment'''<br />
|align="center"| '''Results'''<br />
|align="center"| '''Comments'''<br />
|-<br />
| [[Image:USTC_NANDv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NOTv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI.png|64px]]<br />
|align="center"| [[Image:USTC_NOTv1_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NANDv2a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv2a_Data.png|93px]]<br />
| <font color="orange">Works</font><BR>[[USTC/OperatorPosition|But with slight downstream repression]]<br />
|-<br />
| [[Image:USTC_NANDv2b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[USTC/FailureOfNANDv2b|Failed in<BR>X-gal Assay]]<br />
| [[USTC/OperatorComposition|"Ox7" kind of operators are too weak]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data2.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv3a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3a_Data.png|93px]]<br />
| [[USTC/InterOperatorDistance|Co-repression is too weak]]<BR>[[USTC/OperatorPosition|Downstream solo-repression is to strong]]<br />
|-<br />
| [[Image:USTC_NANDv3b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3b_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NORv2.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv2_Data.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv4.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv4_Data.png|93px]]<br />
| [[USTC/HybridOperator|Hybrid operator do not work as expected]]<br />
|-<br />
| [[Image:USTC_NORv3.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_LacI.png|92px]]<br />
|align="center"| [[Image:USTC_NORv3_Data.png|93px]]<br />
| <font color="red">Works</font><BR>[[USTC/CoRepressedOperator|With a request of co-operator]]<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
----<br />
== Valuable Experiences for Bio-Logic Promoters ==<br />
<br />
=== Factors of Gate-Performances === <br />
The level of repression in vivo is determined by several factors . Because both 'strong' operator and 'weak' operator are required for our system, we systematically tested the effects by the two primary factors: [[USTC/OperatorComposition|'''composition''']] and [[USTC/OperatorPosition|'''position''']].The proper distance between two operators is also necessary for NOR and NAND gates, and data has been [[USTC/InterOperatorDistance|'''reported''']].<br />
<br />
=== Hybrid Operator and Dual-Repressed Operator ===<br />
Based on the data of [[USTC/OperatorComposition|'''operators' composition''']], two ideas has been proposed and attempted to realize:<br />
* [[USTC/HybridOperator|'''Crossbreeding two specific operators''']] may carry out new functions.<br />
* A specific operator repressed by two or more different repressors can be used as [[USTC/DualRepressedOperator|'''a model for NOR gate''']].<br />
<br />
<br />
<br />
<br />
== Repression Assay ==<br />
=== Build Up Promoter Family ===<br />
<br />
[[Image:USTC_PCRBuilding.png|thumb|400px|right|'''Figure ''' PCR Building]]<br />
<br />
Firstly, we extend both sides of the conservative region for transcriptional initiation [[USTC/Logic-Gate_Promoters#References|[9]]] of PlacUV5 [[USTC/Logic-Gate_Promoters#References|[7]]], including -35 box,-10 box and +1 starting point, with two non-sense sequence selected from random groups. The product is named as P_template1 as it is the template for the promoter family. These two non-sense sequence have three main characters:<br />
# They will never include the restriction enzyme cutting sites that will be involved in the whole study;<br />
# They will never include the recognition sites of RNA Polymerases and those of either of the two repressors;<br />
# They will never present in complicated structures.<br />
<br />
Secondly, another group of primers, of which the elongation region at 5’ end may contain a unique operator sequence or each, is applied at both ends of P_template1, equipping us with an according group of promoters with complete structures. These promoters can include variant operator sequences at different position in flank of the conservative region.<br />
<br />
Then the promoter fragments are digested with XbaI and BamHI and loaded into repression-reporter plasmid, which contains <i>lacZ</i> alpha fragment and <i>gfp</i> under the promoter insertion site.<br />
<br />
All the members of the our promoter family are named according to [[USTC/NamingRules|'''a uniform rule''']].<br />
<br />
<br />
=== Solo-Repression Assay ===<br />
<br />
[[Image:SoloRepressionAssay.png|thumb|right|400px|'''Figure''' Solo-Repression]]<br />
<br />
Two plasmids are used in solo-repression assay. First, a plasmid constitutively expressing a specific repressor is transformed into Top10. Then the promoters to be tested, which contain variant operator compositions and positions, are transformed into the strains got in the first step and then selected through double resistance.<br />
<br />
<BR clear="both"><br />
<br />
=== Co-Repression Assay ===<br />
<br />
Promoters to be tested are loaded into double-reporter plasmid and then transformed into the four test strains (CR00, CR01, CR10, CR11). By reading the color of the colonies on plates with X-Gal, and by testing the fluorescence intensity under a fluorescence microscope, we can get the solo-repression and co-repression effects of the two repressors on specific promoters. <br />
[[Image:USTC_CoRepressionAssay.png|thumb|300px|'''Figure''' Co-Repression Assay]]<br />
<br />
{| border="1"<br />
|-<br />
|align="center"|'''Genotype'''<br />
|align="center"|'''Character'''<br />
|align="center"|'''Name'''<br />
|-<br />
|Top10/pT-TERM<br />
|So not express any repressors<br />
|align="center"|CR00<br />
|-<br />
|Top10/pT-ARL4A0604<br />
|Constitutively express ARL4A0604<br />
|align="center"|CR01<br />
|-<br />
|Top10/pT-ARL2A0203<br />
|Constitutively express ARL2A0203<br />
|align="center"|CR10<br />
|-<br />
|Top10/pTet-ARL4A0604-ARL2A203<br />
|Constitutively express ARL4A0604 and ARL2A0203<br />
|align="center"|CR11<br />
|}<br />
<br />
<BR clear="both"><br />
<br />
<br />
<br />
<br />
----<br />
== Final Results ==<br />
<br />
{|<br />
| [[Image:USTC_BestNAND.png|thumb|200px|Best NAND]]<br />
| [[Image:USTC_BestNOR.png|thumb|200px|Best NOR]]<br />
| [[Image:USTC_BestNOT.png|thumb|200px|Best NOT]]<br />
|}<br />
<br />
<br />
=== Suggested Patterns ===<br />
[[Image:USTC_BestSchemes.png|thumb|right|300px|'''Figure 5''' Suggested patterns for NOT, NAND and NOR gates.]]<br />
<br />
'''NAND'''<BR><br />
A NAND Gate requires that two solo-repressions should be weak, and co-repression should be strong. We choose +83.5 to put the upstream operator, to avoid the uncertain activator regions. Another weak operator is put down at the +66.5 site. The relative distance between the two operators is 150, indicating a strong co-repression.<br />
<br />
'''NOR'''<BR><br />
We expected to find a NOR gate with two different operators around the conservative region of a promoter. But there is no available repressor binding site in the upstream of the conservative region based on the observed effect of operator positions. At present only the dual-repressed pattern works well as NOR gate, but it brings us a limitation in wires selecting when assembled into the whole system. <br />
<br />
'''NOT'''<BR><br />
The NOT gate is quite simple, containing only one operator of reverse symmetric structure at the +10.5 site.<br />
<br />
<BR clear="both"><br />
<br />
<br />
<br />
<br />
----<br />
== References ==<br />
<br />
1. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J.; Kuhlman, T. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: applications.', <i>Curr Opin Genet Dev</i> 15(2), 125--135.<br />
<br />
2. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: models.', <i>Curr Opin Genet Dev</i> 15(2), 116--124.<br />
<br />
3. Buchler, N. E.; Gerland, U. & Hwa, T. (2003), 'On schemes of combinatorial transcription logic.', <i>PNAS</i> 100(9), 5136--5141.<br />
<br />
4. Davidson, E. H.; Rast, J. P.; Oliveri, P.; Ransick, A.; Calestani, C.; Yuh, C.; Minokawa, T.; Amore, G.; Hinman, V.; Arenas-Mena, C.; Otim, O.; Brown, C. T.; Livi, C. B.; Lee, P. Y.; Revilla, R.; Rust, A. G.; jun Pan, Z.; Schilstra, M. J.; Clarke, P. J. C.; Arnone, M. I.; Rowen, L.; Cameron, R. A.; McClay, D. R.; Hood, L. & Bolouri, H. (2002), A genomic regulatory network for development., <i>Science</i> 295(5560), 1669--1678.<br />
<br />
5. Elledge, S. J. & Davis, R. W. (1989), 'Position and density effects on repression by stationary and mobile DNA-binding proteins.', <i>Genes Dev</i> 3(2), 185--197.<br />
<br />
6. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
7. Lanzer, M. & Bujard, H. (1988), 'Promoters largely determine the efficiency of repressor action.', <i>PNAS</i> 85(23), 8973--8977.<br />
<br />
8. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328(6), 521--548.<br />
<br />
9. Rojo, F. (1999), 'Repression of transcription initiation in bacteria.', <i>J Bacteriol</i> 181(10), 2987--2991.<br />
<br />
10. Saiz, L. & Vilar, J. M. G. (2006), 'DNA looping: the consequences and its control.', <i>Curr Opin Struct Biol</i> 16(3), 344--350.<br />
<br />
11. Sheridan, S. D.; Opel, M. L. & Hatfield, G. W. (2001), 'Activation and repression of transcription initiation by a distant DNA structural transition.', <i>Mol Microbiol</i> 40(3), 684--690.<br />
<br />
12. [http://cnse.albany.edu/News/index.cfm?step=show_detail&NewsID=424 Semiconductor International: 45 to 32 nm: Another Evolutionary Transition.]<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Logic-Gate_PromotersUSTC/Logic-Gate Promoters2007-10-26T15:17:24Z<p>MaRui: </p>
<hr />
<div><br />
<br />
== Cis-acting Bio-Logic Gates ==<br />
<br />
In natural cells, combinational logic computation can be carried out by cis-acting elements [[USTC/Logic-Gate_Promoters#References|[4]]]. Theoretically, dual repressors interacting on two adjacent operators can generate complex logic function as NAND, NOT and NOT [[USTC/Logic-Gate_Promoters#References|[1,2,3]]]. However, seldom of the parameters of these models has been measured, and practical artificial logic promoters are hard to make because of the lack of appropriate inputs. In this project, we simplify these models to reduce the number of parameters, use artificial high-specific repressors based-on Lac repressor [[USTC/Logic-Gate_Promoters#References|[8]]] to serve as inputs, predict possible patterns of logic promoters, construct and test them experimentally, all to attempt to find a systematical way to construct cis-acting bio-logic promoters. As a result, a piece of DNA about 60 – 200bp is able to be built up and to act as a logic gate.<br />
<br />
=== Advatanges of Cis-acting Bio-Logic Gates ===<br />
# Work in vivo and can be genetically inherited<br />
# Can be systematically built up according to several patterns<br />
# Small in scale<br />
#* About 2.0nm in width, 20 - 70nm in length, similar to transistors in present VSLI in size [[USTC/Logic-Gate_Promoters#References|[12]]], sometimes even smaller<br />
# Can be cascaded to implement any complex combinational logic computation<br />
#* And is also able to form sequential circuit<br />
<br />
<br />
<br />
<br />
== Repression Model ==<br />
<br />
[[Image:USTC_RepressionModel.png|thumb|right|300px|'''Figure 1''' (a) Sketch map of solo-repression. (b) Sketch map of co-repression.]]<br />
<br />
Lacramioara Bintu et al. have reported a simple thermodynamic model which can quantify promoter activity under one or more regulatory factors [[USTC/Logic-Gate_Promoters#References|[1,2]]]. In this project, we focus on the multiple changes of promoter activity under the existence of one or two repressors. For a weak promoter, the multiple of its change can be approximately described as a function of different repressor concentrations, inter-operator distances, repressor–operator affinity and repressor-repressor interactions.<br />
<br />
For a promoter containing a single operator site shown in Figure 1(a), the promoter activity under <i>R</i> repressor molecules <i>A(R)</i> is:<br />
<br />
[[Image:USTC_RepressionModel_FC_Solo.png|center]]<br />
<br />
Note that <i>A(0)</i> is the promoter activity without repression; <i>&rho;(P)</i> is the solo-repression coefficient of the operator at the position <i>P</i>; <i>&Delta;&epsilon;(O)</i> is the difference of binding energy of operator <i>O</i> on specific sites to non-specific sites; <i>N<sub>NS</sub></i> is the number of non-specific sites; and <i>K<sub>B</sub></i> means the Boltzmann constant, <i>T</i> is the temperature.<br />
<br />
For a promoter containing two different operators, of which the relative repressors may be able to interact with each other shown in Figure 1(b), the promoter activity under combinations of two repressors, R<sub>A</sub> and R<sub>B</sub>, is given as:<br />
<br />
[[Image:USTC_RepressionModel_FC_Co.png|center]]<br />
<br />
Where <i>&omega;(P<sub>A</sub>, P<sub>B</sub>)</i> is the co-repression coefficient when O<sub>A</sub> is located at <i>P<sub>A</sub></i>, and O<sub>B</sub> at <i>P<sub>B</sub></i>.<br />
<br />
Concerning a NOT gate which works under approximately equal high or low repressor concentration, R<sub>low</sub>=0 and R<sub>high</sub>=R<sub>H</sub>, we assessed its performance by giving it a score:<br />
<br />
[[Image:USTC_RepressionModel_NOT_Score.png|center]]<br />
<br />
In the same way, NAND score and NOR score are:<br />
<br />
[[Image:USTC_RepressionModel_NAND_Score.png|center]]<br />
<br />
[[Image:USTC_RepressionModel_NOR_Score.png|center]]<br />
<br />
In the situation with a fixed combination of two repressors, R<sub>A</sub> and R<sub>B</sub>, and approximately equal high or low repressor concentration, the logic performance of a promoter is a function of inter-operator distances, repressor–operator affinity and repressor-repressor interactions. By adjusting these parameters, it is possible to find out well-performing bio-logic promoters.<br />
<br />
<br />
<br />
<br />
----<br />
== Schemes of Bio-Logic Promoters ==<br />
<br />
Dozens of potential bio-logic patterns were experimentally synthesized and tested in solo-repression or co-repression test-bench. Some representative ones are shown and commented as following.<br />
<br />
{| border="1"<br />
|-<br />
|align="center"| '''Scheme'''<br />
|align="center"| '''Test-environment'''<br />
|align="center"| '''Results'''<br />
|align="center"| '''Comments'''<br />
|-<br />
| [[Image:USTC_NANDv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NOTv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI.png|64px]]<br />
|align="center"| [[Image:USTC_NOTv1_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NANDv2a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv2a_Data.png|93px]]<br />
| <font color="orange">Works</font><BR>[[USTC/OperatorPosition|But with slight downstream repression]]<br />
|-<br />
| [[Image:USTC_NANDv2b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[USTC/FailureOfNANDv2b|Failed in<BR>X-gal Assay]]<br />
| [[USTC/OperatorComposition|"Ox7" kind of operators are too weak]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data2.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv3a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3a_Data.png|93px]]<br />
| [[USTC/InterOperatorDistance|Co-repression is too weak]]<BR>[[USTC/OperatorPosition|Downstream solo-repression is to strong]]<br />
|-<br />
| [[Image:USTC_NANDv3b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3b_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NORv2.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv2_Data.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv4.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv4_Data.png|93px]]<br />
| [[USTC/HybridOperator|Hybrid operator do not work as expected]]<br />
|-<br />
| [[Image:USTC_NORv3.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_LacI.png|92px]]<br />
|align="center"| [[Image:USTC_NORv3_Data.png|93px]]<br />
| <font color="red">Works</font><BR>[[USTC/CoRepressedOperator|With a request of co-operator]]<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
----<br />
== Valuable Experiences for Bio-Logic Promoters ==<br />
<br />
=== Factors of Gate-Performances === <br />
The level of repression in vivo is determined by several factors . Because both 'strong' operator and 'weak' operator are required for our system, we systematically tested the effects by the two primary factors: [[USTC/OperatorComposition|'''composition''']] and [[USTC/OperatorPosition|'''position''']].The proper distance between two operators is also necessary for NOR and NAND gates, and data has been [[USTC/InterOperatorDistance|'''reported''']].<br />
<br />
=== Hybrid Operator and Dual-Repressed Operator ===<br />
Based on the data of [[USTC/OperatorComposition|'''operators' composition''']], two ideas has been proposed and attempted to realize:<br />
* [[USTC/HybridOperator|'''Crossbreeding two specific operators''']] may carry out new functions.<br />
* A specific operator repressed by two or more different repressors can be used as [[USTC/DualRepressedOperator|'''a model for NOR gate''']].<br />
<br />
<br />
<br />
<br />
== Repression Assay ==<br />
=== Build Up Promoter Family ===<br />
<br />
[[Image:USTC_PCRBuilding.png|thumb|400px|right|'''Figure ''' PCR Building]]<br />
<br />
Firstly, we extend both sides of the conservative region for transcriptional initiation [[USTC/Logic-Gate_Promoters#References|[9]]] of PlacUV5 [[USTC/Logic-Gate_Promoters#References|[7]]], including -35 box,-10 box and +1 starting point, with two non-sense sequence selected from random groups. The product is named as P_template1 as it is the template for the promoter family. These two non-sense sequence have three main characters:<br />
# They will never include the restriction enzyme cutting sites that will be involved in the whole study;<br />
# They will never include the recognition sites of RNA Polymerases and those of either of the two repressors;<br />
# They will never present in complicated structures.<br />
<br />
Secondly, another group of primers, of which the elongation region at 5’ end may contain a unique operator sequence or each, is applied at both ends of P_template1, equipping us with an according group of promoters with complete structures. These promoters can include variant operator sequences at different position in flank of the conservative region.<br />
<br />
Then the promoter fragments are digested with XbaI and BamHI and loaded into repression-reporter plasmid, which contains <i>lacZ</i> alpha fragment and <i>gfp</i> under the promoter insertion site.<br />
<br />
All the members of the our promoter family are named according to [[USTC/NamingRules|'''a uniform rule''']].<br />
<br />
<br />
=== Solo-Repression Assay ===<br />
<br />
[[Image:SoloRepressionAssay.png|thumb|right|400px|'''Figure''' Solo-Repression]]<br />
<br />
Two plasmids are used in solo-repression assay. First, a plasmid constitutively expressing a specific repressor is transformed into Top10. Then the promoters to be tested, which contain variant operator compositions and positions, are transformed into the strains got in the first step and then selected through double resistance.<br />
<br />
<BR clear="both"><br />
<br />
=== Co-Repression Assay ===<br />
<br />
Promoters to be tested are loaded into double-reporter plasmid and then transformed into the four test strains (CR00, CR01, CR10, CR11). By reading the color of the colonies on plates with X-Gal, and by testing the fluorescence intensity under a fluorescence microscope, we can get the solo-repression and co-repression effects of the two repressors on specific promoters. <br />
[[Image:USTC_CoRepressionAssay.png|thumb|300px|'''Figure''' Co-Repression Assay]]<br />
<br />
{| border="1"<br />
|-<br />
|align="center"|'''Genotype'''<br />
|align="center"|'''Character'''<br />
|align="center"|'''Name'''<br />
|-<br />
|Top10/pT-TERM<br />
|So not express any repressors<br />
|align="center"|CR00<br />
|-<br />
|Top10/pT-ARL4A0604<br />
|Constitutively express ARL4A0604<br />
|align="center"|CR01<br />
|-<br />
|Top10/pT-ARL2A0203<br />
|Constitutively express ARL2A0203<br />
|align="center"|CR10<br />
|-<br />
|Top10/pTet-ARL4A0604-ARL2A203<br />
|Constitutively express ARL4A0604 and ARL2A0203<br />
|align="center"|CR11<br />
|}<br />
<br />
<BR clear="both"><br />
<br />
<br />
<br />
<br />
----<br />
== Final Results ==<br />
<br />
{|<br />
| [[Image:USTC_BestNAND.png|thumb|200px|Best NAND]]<br />
| [[Image:USTC_BestNOR.png|thumb|200px|Best NOR]]<br />
| [[Image:USTC_BestNOT.png|thumb|200px|Best NOT]]<br />
|}<br />
<br />
<br />
=== Suggested Patterns ===<br />
[[Image:USTC_BestSchemes.png|thumb|right|300px|'''Figure 5''' Suggested patterns for NOT, NAND and NOR gates.]]<br />
<br />
'''NAND'''<BR><br />
A NAND Gate requires that two solo-repressions should be weak, and co-repression should be strong. We choose +83.5 to put the upstream operator, to avoid the uncertain activator regions. Another weak operator is put down at the +66.5 site. The relative distance between the two operators is 150, indicating a strong co-repression.<br />
<br />
'''NOR'''<BR><br />
We expected to find a NOR gate with two different operators around the conservative region of a promoter. But there is no available repressor binding site in the upstream of the conservative region based on the observed effect of operator positions. At present only the dual-repressed pattern works well as NOR gate, but it brings us a limitation in wires selecting when assembled into the whole system. <br />
<br />
'''NOT'''<BR><br />
The NOT gate is quite simple, containing only one operator of reverse symmetric structure at the +10.5 site.<br />
<br />
<BR clear="both"><br />
<br />
<br />
<br />
<br />
----<br />
== References ==<br />
<br />
1. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J.; Kuhlman, T. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: applications.', <i>Curr Opin Genet Dev</i> 15(2), 125--135.<br />
<br />
2. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: models.', <i>Curr Opin Genet Dev</i> 15(2), 116--124.<br />
<br />
3. Buchler, N. E.; Gerland, U. & Hwa, T. (2003), 'On schemes of combinatorial transcription logic.', <i>PNAS</i> 100(9), 5136--5141.<br />
<br />
4. Davidson, E. H.; Rast, J. P.; Oliveri, P.; Ransick, A.; Calestani, C.; Yuh, C.; Minokawa, T.; Amore, G.; Hinman, V.; Arenas-Mena, C.; Otim, O.; Brown, C. T.; Livi, C. B.; Lee, P. Y.; Revilla, R.; Rust, A. G.; jun Pan, Z.; Schilstra, M. J.; Clarke, P. J. C.; Arnone, M. I.; Rowen, L.; Cameron, R. A.; McClay, D. R.; Hood, L. & Bolouri, H. (2002), A genomic regulatory network for development., <i>Science</i> 295(5560), 1669--1678.<br />
<br />
5. Elledge, S. J. & Davis, R. W. (1989), 'Position and density effects on repression by stationary and mobile DNA-binding proteins.', <i>Genes Dev</i> 3(2), 185--197.<br />
<br />
6. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
7. Lanzer, M. & Bujard, H. (1988), 'Promoters largely determine the efficiency of repressor action.', <i>PNAS</i> 85(23), 8973--8977.<br />
<br />
8. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328(6), 521--548.<br />
<br />
9. Rojo, F. (1999), 'Repression of transcription initiation in bacteria.', <i>J Bacteriol</i> 181(10), 2987--2991.<br />
<br />
10. Saiz, L. & Vilar, J. M. G. (2006), 'DNA looping: the consequences and its control.', <i>Curr Opin Struct Biol</i> 16(3), 344--350.<br />
<br />
11. Sheridan, S. D.; Opel, M. L. & Hatfield, G. W. (2001), 'Activation and repression of transcription initiation by a distant DNA structural transition.', <i>Mol Microbiol</i> 40(3), 684--690.<br />
<br />
12. [http://cnse.albany.edu/News/index.cfm?step=show_detail&NewsID=424 Semiconductor International: 45 to 32 nm: Another Evolutionary Transition.]<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Logic-Gate_PromotersUSTC/Logic-Gate Promoters2007-10-26T15:10:36Z<p>MaRui: </p>
<hr />
<div>== Cis-acting Bio-Logic Gates ==<br />
<br />
In natural cells, combinational logic computation can be carried out by cis-acting elements [[USTC/Logic-Gate_Promoters#References|[4]]]. Theoretically, dual repressors interacting on two adjacent operators can generate complex logic function as NAND, NOT and NOT [[USTC/Logic-Gate_Promoters#References|[1,2,3]]]. However, seldom of the parameters of these models has been measured, and practical artificial logic promoters are hard to make because of the lack of appropriate inputs. In this project, we simplify these models to reduce the number of parameters, use artificial high-specific repressors based-on Lac repressor [[USTC/Logic-Gate_Promoters#References|[8]]] to serve as inputs, predict possible patterns of logic promoters, construct and test them experimentally, all to attempt to find a systematical way to construct cis-acting bio-logic promoters. As a result, a piece of DNA about 60 – 200bp is able to be built up and to act as a logic gate.<br />
<br />
<br />
=== Advatanges of Cis-acting Bio-Logic Gates ===<br />
# Work in vivo and can be genetically inherited<br />
# Can be systematically built up according to several patterns<br />
# Small in scale<br />
#* About 2.0nm in width, 20 - 70nm in length, similar to transistors in present VSLI in size [[USTC/Logic-Gate_Promoters#References|[12]]], sometimes even smaller<br />
# Can be cascaded to implement any complex combinational logic computation<br />
#* And is also able to form sequential circuit<br />
<br />
== Repression Model ==<br />
<br />
[[Image:USTC_RepressionModel.png|thumb|right|300px|'''Figure 1''' (a) Sketch map of solo-repression. (b) Sketch map of co-repression.]]<br />
<br />
Lacramioara Bintu et al. have reported a simple thermodynamic model which can quantify promoter activity under one or more regulatory factors [[USTC/Logic-Gate_Promoters#References|[1,2]]]. In this project, we focus on the multiple changes of promoter activity under the existence of one or two repressors. For a weak promoter, the multiple of its change can be approximately described as a function of different repressor concentrations, inter-operator distances, repressor–operator affinity and repressor-repressor interactions.<br />
<br />
For a promoter containing a single operator site shown in Figure 1(a), the promoter activity under <i>R</i> repressor molecules <i>A(R)</i> is:<br />
<br />
[[Image:USTC_RepressionModel_FC_Solo.png|center]]<br />
<br />
Note that <i>A(0)</i> is the promoter activity without repression; <i>&rho;(P)</i> is the solo-repression coefficient of the operator at the position <i>P</i>; <i>&Delta;&epsilon;(O)</i> is the difference of binding energy of operator <i>O</i> on specific sites to non-specific sites; <i>N<sub>NS</sub></i> is the number of non-specific sites; and <i>K<sub>B</sub></i> means the Boltzmann constant, <i>T</i> is the temperature.<br />
<br />
For a promoter containing two different operators, of which the relative repressors may be able to interact with each other shown in Figure 1(b), the promoter activity under combinations of two repressors, R<sub>A</sub> and R<sub>B</sub>, is given as:<br />
<br />
[[Image:USTC_RepressionModel_FC_Co.png|center]]<br />
<br />
Where <i>&omega;(P<sub>A</sub>, P<sub>B</sub>)</i> is the co-repression coefficient when O<sub>A</sub> is located at <i>P<sub>A</sub></i>, and O<sub>B</sub> at <i>P<sub>B</sub></i>.<br />
<br />
Concerning a NOT gate which works under approximately equal high or low repressor concentration, R<sub>low</sub>=0 and R<sub>high</sub>=R<sub>H</sub>, we assessed its performance by giving it a score:<br />
<br />
[[Image:USTC_RepressionModel_NOT_Score.png|center]]<br />
<br />
In the same way, NAND score and NOR score are:<br />
<br />
[[Image:USTC_RepressionModel_NAND_Score.png|center]]<br />
<br />
[[Image:USTC_RepressionModel_NOR_Score.png|center]]<br />
<br />
In the situation with a fixed combination of two repressors, R<sub>A</sub> and R<sub>B</sub>, and approximately equal high or low repressor concentration, the logic performance of a promoter is a function of inter-operator distances, repressor–operator affinity and repressor-repressor interactions. By adjusting these parameters, it is possible to find out well-performing bio-logic promoters.<br />
<br />
<br />
----<br />
<br />
<br />
== Schemes of Bio-Logic Promoters ==<br />
<br />
Dozens of potential bio-logic patterns were experimentally synthesized and tested in solo-repression or co-repression test-bench. Some representative ones are shown and commented as following.<br />
<br />
{| border="1"<br />
|-<br />
|align="center"| '''Scheme'''<br />
|align="center"| '''Test-environment'''<br />
|align="center"| '''Results'''<br />
|align="center"| '''Comments'''<br />
|-<br />
| [[Image:USTC_NANDv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NOTv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI.png|64px]]<br />
|align="center"| [[Image:USTC_NOTv1_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NANDv2a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv2a_Data.png|93px]]<br />
| <font color="orange">Works</font><BR>[[USTC/OperatorPosition|But with slight downstream repression]]<br />
|-<br />
| [[Image:USTC_NANDv2b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[USTC/FailureOfNANDv2b|Failed in<BR>X-gal Assay]]<br />
| [[USTC/OperatorComposition|"Ox7" kind of operators are too weak]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data2.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv3a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3a_Data.png|93px]]<br />
| [[USTC/InterOperatorDistance|Co-repression is too weak]]<BR>[[USTC/OperatorPosition|Downstream solo-repression is to strong]]<br />
|-<br />
| [[Image:USTC_NANDv3b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3b_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NORv2.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv2_Data.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv4.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv4_Data.png|93px]]<br />
| [[USTC/HybridOperator|Hybrid operator do not work as expected]]<br />
|-<br />
| [[Image:USTC_NORv3.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_LacI.png|92px]]<br />
|align="center"| [[Image:USTC_NORv3_Data.png|93px]]<br />
| <font color="red">Works</font><BR>[[USTC/CoRepressedOperator|With a request of co-operator]]<br />
|-<br />
|}<br />
<br />
<br />
----<br />
<br />
== Valuable Experiences for Bio-Logic Promoters ==<br />
<br />
=== Factors of Gate-Performances === <br />
The level of repression in vivo is determined by several factors . Because both 'strong' operator and 'weak' operator are required for our system, we systematically tested the effects by the two primary factors: [[USTC/OperatorComposition|'''composition''']] and [[USTC/OperatorPosition|'''position''']].The proper distance between two operators is also necessary for NOR and NAND gates, and data has been [[USTC/InterOperatorDistance|'''reported''']].<br />
<br />
=== Hybrid Operator and Dual-Repressed Operator ===<br />
Based on the data of [[USTC/OperatorComposition|'''operators' composition''']], two ideas has been proposed and attempted to realize:<br />
* [[USTC/HybridOperator|'''Crossbreeding two specific operators''']] may carry out new functions.<br />
* A specific operator repressed by two or more different repressors can be used as [[USTC/DualRepressedOperator|'''a model for NOR gate''']].<br />
<br />
<br />
<br />
<br />
<br />
== Repression Assay ==<br />
=== Build Up Promoter Family ===<br />
<br />
[[Image:USTC_PCRBuilding.png|thumb|400px|right|'''Figure ''' PCR Building]]<br />
<br />
Firstly, we extend both sides of the conservative region for transcriptional initiation [[USTC/Logic-Gate_Promoters#References|[9]]] of PlacUV5 [[USTC/Logic-Gate_Promoters#References|[7]]], including -35 box,-10 box and +1 starting point, with two non-sense sequence selected from random groups. The product is named as P_template1 as it is the template for the promoter family. These two non-sense sequence have three main characters:<br />
# They will never include the restriction enzyme cutting sites that will be involved in the whole study;<br />
# They will never include the recognition sites of RNA Polymerases and those of either of the two repressors;<br />
# They will never present in complicated structures.<br />
<br />
Secondly, another group of primers, of which the elongation region at 5’ end may contain a unique operator sequence or each, is applied at both ends of P_template1, equipping us with an according group of promoters with complete structures. These promoters can include variant operator sequences at different position in flank of the conservative region.<br />
<br />
Then the promoter fragments are digested with XbaI and BamHI and loaded into repression-reporter plasmid, which contains <i>lacZ</i> alpha fragment and <i>gfp</i> under the promoter insertion site.<br />
<br />
All the members of the our promoter family are named according to [[USTC/NamingRules|'''a uniform rule''']].<br />
<br />
<br />
=== Solo-Repression Assay ===<br />
<br />
[[Image:SoloRepressionAssay.png|thumb|right|400px|'''Figure''' Solo-Repression]]<br />
<br />
Two plasmids are used in solo-repression assay. First, a plasmid constitutively expressing a specific repressor is transformed into Top10. Then the promoters to be tested, which contain variant operator compositions and positions, are transformed into the strains got in the first step and then selected through double resistance.<br />
<br />
<BR clear="both"><br />
<br />
=== Co-Repression Assay ===<br />
<br />
Promoters to be tested are loaded into double-reporter plasmid and then transformed into the four test strains (CR00, CR01, CR10, CR11). By reading the color of the colonies on plates with X-Gal, and by testing the fluorescence intensity under a fluorescence microscope, we can get the solo-repression and co-repression effects of the two repressors on specific promoters. <br />
[[Image:USTC_CoRepressionAssay.png|thumb|300px|'''Figure''' Co-Repression Assay]]<br />
<br />
{| border="1"<br />
|-<br />
|align="center"|'''Genotype'''<br />
|align="center"|'''Character'''<br />
|align="center"|'''Name'''<br />
|-<br />
|Top10/pT-TERM<br />
|So not express any repressors<br />
|align="center"|CR00<br />
|-<br />
|Top10/pT-ARL4A0604<br />
|Constitutively express ARL4A0604<br />
|align="center"|CR01<br />
|-<br />
|Top10/pT-ARL2A0203<br />
|Constitutively express ARL2A0203<br />
|align="center"|CR10<br />
|-<br />
|Top10/pTet-ARL4A0604-ARL2A203<br />
|Constitutively express ARL4A0604 and ARL2A0203<br />
|align="center"|CR11<br />
|}<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== Final Results ==<br />
<br />
{|<br />
| [[Image:USTC_BestNAND.png|thumb|200px|Best NAND]]<br />
| [[Image:USTC_BestNOR.png|thumb|200px|Best NOR]]<br />
| [[Image:USTC_BestNOT.png|thumb|200px|Best NOT]]<br />
|}<br />
<br />
<br />
=== Suggested Patterns ===<br />
[[Image:USTC_BestSchemes.png|thumb|right|300px|'''Figure 5''' Suggested patterns for NOT, NAND and NOR gates.]]<br />
<br />
'''NAND'''<BR><br />
A NAND Gate requires that two solo-repressions should be weak, and co-repression should be strong. We choose +83.5 to put the upstream operator, to avoid the uncertain activator regions. Another weak operator is put down at the +66.5 site. The relative distance between the two operators is 150, indicating a strong co-repression.<br />
<br />
'''NOR'''<BR><br />
We expected to find a NOR gate with two different operators around the conservative region of a promoter. But there is no available repressor binding site in the upstream of the conservative region based on the observed effect of operator positions. At present only the dual-repressed pattern works well as NOR gate, but it brings us a limitation in wires selecting when assembled into the whole system. <br />
<br />
'''NOT'''<BR><br />
The NOT gate is quite simple, containing only one operator of reverse symmetric structure at the +10.5 site.<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== References ==<br />
<br />
1. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J.; Kuhlman, T. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: applications.', <i>Curr Opin Genet Dev</i> 15(2), 125--135.<br />
<br />
2. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: models.', <i>Curr Opin Genet Dev</i> 15(2), 116--124.<br />
<br />
3. Buchler, N. E.; Gerland, U. & Hwa, T. (2003), 'On schemes of combinatorial transcription logic.', <i>PNAS</i> 100(9), 5136--5141.<br />
<br />
4. Davidson, E. H.; Rast, J. P.; Oliveri, P.; Ransick, A.; Calestani, C.; Yuh, C.; Minokawa, T.; Amore, G.; Hinman, V.; Arenas-Mena, C.; Otim, O.; Brown, C. T.; Livi, C. B.; Lee, P. Y.; Revilla, R.; Rust, A. G.; jun Pan, Z.; Schilstra, M. J.; Clarke, P. J. C.; Arnone, M. I.; Rowen, L.; Cameron, R. A.; McClay, D. R.; Hood, L. & Bolouri, H. (2002), A genomic regulatory network for development., <i>Science</i> 295(5560), 1669--1678.<br />
<br />
5. Elledge, S. J. & Davis, R. W. (1989), 'Position and density effects on repression by stationary and mobile DNA-binding proteins.', <i>Genes Dev</i> 3(2), 185--197.<br />
<br />
6. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
7. Lanzer, M. & Bujard, H. (1988), 'Promoters largely determine the efficiency of repressor action.', <i>PNAS</i> 85(23), 8973--8977.<br />
<br />
8. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328(6), 521--548.<br />
<br />
9. Rojo, F. (1999), 'Repression of transcription initiation in bacteria.', <i>J Bacteriol</i> 181(10), 2987--2991.<br />
<br />
10. Saiz, L. & Vilar, J. M. G. (2006), 'DNA looping: the consequences and its control.', <i>Curr Opin Struct Biol</i> 16(3), 344--350.<br />
<br />
11. Sheridan, S. D.; Opel, M. L. & Hatfield, G. W. (2001), 'Activation and repression of transcription initiation by a distant DNA structural transition.', <i>Mol Microbiol</i> 40(3), 684--690.<br />
<br />
12. [http://cnse.albany.edu/News/index.cfm?step=show_detail&NewsID=424 Semiconductor International: 45 to 32 nm: Another Evolutionary Transition.]<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Logic-Gate_PromotersUSTC/Logic-Gate Promoters2007-10-26T15:08:49Z<p>MaRui: </p>
<hr />
<div>== Cis-acting Bio-Logic Gates ==<br />
<br />
In natural cells, combinational logic computation can be carried out by cis-acting elements [[USTC/Logic-Gate_Promoters#References|[4]]]. Theoretically, dual repressors interacting on two adjacent operators can generate complex logic function as NAND, NOT and NOT [[USTC/Logic-Gate_Promoters#References|[1,2,3]]]. However, seldom of the parameters of these models has been measured, and practical artificial logic promoters are hard to make because of the lack of appropriate inputs. In this project, we simplify these models to reduce the number of parameters, use artificial high-specific repressors based-on Lac repressor [[USTC/Logic-Gate_Promoters#References|[8]]] to serve as inputs, predict possible patterns of logic promoters, construct and test them experimentally, all to attempt to find a systematical way to construct cis-acting bio-logic promoters. As a result, a piece of DNA about 60 – 200bp is able to be built up and to act as a logic gate.<br />
<br />
<br />
=== Advatanges of Cis-acting Bio-Logic Gates ===<br />
# Work in vivo and can be genetically inherited<br />
# Can be systematically built up according to several patterns<br />
# Small in scale<br />
#* About 2.0nm in width, 20 - 70nm in length, similar to transistors in present VSLI in size [[USTC/Logic-Gate_Promoters#References|[12]]], sometimes even smaller<br />
# Can be cascaded to implement any complex combinational logic computation<br />
#* And is also able to form sequential circuit<br />
<br />
== Repression Model ==<br />
<br />
[[Image:USTC_RepressionModel.png|thumb|right|300px|'''Figure 1''' (a) Sketch map of solo-repression. (b) Sketch map of co-repression.]]<br />
<br />
Lacramioara Bintu et al. have reported a simple thermodynamic model which can quantify promoter activity under one or more regulatory factors [[USTC/Logic-Gate_Promoters#References|[1,2]]]. In this project, we focus on the multiple changes of promoter activity under the existence of one or two repressors. For a weak promoter, the multiple of its change can be approximately described as a function of different repressor concentrations, inter-operator distances, repressor–operator affinity and repressor-repressor interactions.<br />
<br />
For a promoter containing a single operator site shown in Figure 1(a), the promoter activity under <i>R</i> repressor molecules <i>A(R)</i> is:<br />
<br />
[[Image:USTC_RepressionModel_FC_Solo.png|center]]<br />
<br />
Note that <i>A(0)</i> is the promoter activity without repression; <i>&rho;(P)</i> is the solo-repression coefficient of the operator at the position <i>P</i>; <i>&Delta;&epsilon;(O)</i> is the difference of binding energy of operator <i>O</i> on specific sites to non-specific sites; <i>N<sub>NS</sub></i> is the number of non-specific sites; and <i>K<sub>B</sub></i> means the Boltzmann constant, <i>T</i> is the temperature.<br />
<br />
For a promoter containing two different operators, of which the relative repressors may be able to interact with each other shown in Figure 1(b), the promoter activity under combinations of two repressors, R<sub>A</sub> and R<sub>B</sub>, is given as:<br />
<br />
[[Image:USTC_RepressionModel_FC_Co.png|center]]<br />
<br />
Where <i>&omega;(P<sub>A</sub>, P<sub>B</sub>)</i> is the co-repression coefficient when O<sub>A</sub> is located at <i>P<sub>A</sub></i>, and O<sub>B</sub> at <i>P<sub>B</sub></i>.<br />
<br />
Concerning a NOT gate which works under approximately equal high or low repressor concentration, R<sub>low</sub>=0 and R<sub>high</sub>=R<sub>H</sub>, we assessed its performance by giving it a score:<br />
<br />
[[Image:USTC_RepressionModel_NOT_Score.png|center]]<br />
<br />
In the same way, NAND score and NOR score are:<br />
<br />
[[Image:USTC_RepressionModel_NAND_Score.png|center]]<br />
<br />
[[Image:USTC_RepressionModel_NOR_Score.png|center]]<br />
<br />
In the situation with a fixed combination of two repressors, R<sub>A</sub> and R<sub>B</sub>, and approximately equal high or low repressor concentration, the logic performance of a promoter is a function of inter-operator distances, repressor–operator affinity and repressor-repressor interactions. By adjusting these parameters, it is possible to find out well-performing bio-logic promoters.<br />
<br />
<br />
<br />
<br />
== Schemes of Bio-Logic Promoters ==<br />
<br />
Dozens of potential bio-logic patterns were experimentally synthesized and tested in solo-repression or co-repression test-bench. Some representative ones are shown and commented as following.<br />
<br />
{| border="1"<br />
|-<br />
|align="center"| '''Scheme'''<br />
|align="center"| '''Test-environment'''<br />
|align="center"| '''Results'''<br />
|align="center"| '''Comments'''<br />
|-<br />
| [[Image:USTC_NANDv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NOTv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI.png|64px]]<br />
|align="center"| [[Image:USTC_NOTv1_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NANDv2a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv2a_Data.png|93px]]<br />
| <font color="orange">Works</font><BR>[[USTC/OperatorPosition|But with slight downstream repression]]<br />
|-<br />
| [[Image:USTC_NANDv2b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[USTC/FailureOfNANDv2b|Failed in<BR>X-gal Assay]]<br />
| [[USTC/OperatorComposition|"Ox7" kind of operators are too weak]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data2.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv3a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3a_Data.png|93px]]<br />
| [[USTC/InterOperatorDistance|Co-repression is too weak]]<BR>[[USTC/OperatorPosition|Downstream solo-repression is to strong]]<br />
|-<br />
| [[Image:USTC_NANDv3b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3b_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NORv2.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv2_Data.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv4.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv4_Data.png|93px]]<br />
| [[USTC/HybridOperator|Hybrid operator do not work as expected]]<br />
|-<br />
| [[Image:USTC_NORv3.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_LacI.png|92px]]<br />
|align="center"| [[Image:USTC_NORv3_Data.png|93px]]<br />
| <font color="red">Works</font><BR>[[USTC/CoRepressedOperator|With a request of co-operator]]<br />
|-<br />
|}<br />
<br />
<br />
<br />
<br />
== Valuable Experiences for Bio-Logic Promoters ==<br />
<br />
=== Factors of Gate-Performances === <br />
The level of repression in vivo is determined by several factors . Because both 'strong' operator and 'weak' operator are required for our system, we systematically tested the effects by the two primary factors: [[USTC/OperatorComposition|'''composition''']] and [[USTC/OperatorPosition|'''position''']].The proper distance between two operators is also necessary for NOR and NAND gates, and data has been [[USTC/InterOperatorDistance|'''reported''']].<br />
<br />
=== Hybrid Operator and Dual-Repressed Operator ===<br />
Based on the data of [[USTC/OperatorComposition|'''operators' composition''']], two ideas has been proposed and attempted to realize:<br />
* [[USTC/HybridOperator|'''Crossbreeding two specific operators''']] may carry out new functions.<br />
* A specific operator repressed by two or more different repressors can be used as [[USTC/DualRepressedOperator|'''a model for NOR gate''']].<br />
<br />
<br />
<br />
<br />
<br />
== Repression Assay ==<br />
=== Build Up Promoter Family ===<br />
<br />
[[Image:USTC_PCRBuilding.png|thumb|400px|right|'''Figure ''' PCR Building]]<br />
<br />
Firstly, we extend both sides of the conservative region for transcriptional initiation [[USTC/Logic-Gate_Promoters#References|[9]]] of PlacUV5 [[USTC/Logic-Gate_Promoters#References|[7]]], including -35 box,-10 box and +1 starting point, with two non-sense sequence selected from random groups. The product is named as P_template1 as it is the template for the promoter family. These two non-sense sequence have three main characters:<br />
# They will never include the restriction enzyme cutting sites that will be involved in the whole study;<br />
# They will never include the recognition sites of RNA Polymerases and those of either of the two repressors;<br />
# They will never present in complicated structures.<br />
<br />
Secondly, another group of primers, of which the elongation region at 5’ end may contain a unique operator sequence or each, is applied at both ends of P_template1, equipping us with an according group of promoters with complete structures. These promoters can include variant operator sequences at different position in flank of the conservative region.<br />
<br />
Then the promoter fragments are digested with XbaI and BamHI and loaded into repression-reporter plasmid, which contains <i>lacZ</i> alpha fragment and <i>gfp</i> under the promoter insertion site.<br />
<br />
All the members of the our promoter family are named according to [[USTC/NamingRules|'''a uniform rule''']].<br />
<br />
<br />
=== Solo-Repression Assay ===<br />
<br />
[[Image:SoloRepressionAssay.png|thumb|right|400px|'''Figure''' Solo-Repression]]<br />
<br />
Two plasmids are used in solo-repression assay. First, a plasmid constitutively expressing a specific repressor is transformed into Top10. Then the promoters to be tested, which contain variant operator compositions and positions, are transformed into the strains got in the first step and then selected through double resistance.<br />
<br />
<BR clear="both"><br />
<br />
=== Co-Repression Assay ===<br />
<br />
Promoters to be tested are loaded into double-reporter plasmid and then transformed into the four test strains (CR00, CR01, CR10, CR11). By reading the color of the colonies on plates with X-Gal, and by testing the fluorescence intensity under a fluorescence microscope, we can get the solo-repression and co-repression effects of the two repressors on specific promoters. <br />
[[Image:USTC_CoRepressionAssay.png|thumb|300px|'''Figure''' Co-Repression Assay]]<br />
<br />
{| border="1"<br />
|-<br />
|align="center"|'''Genotype'''<br />
|align="center"|'''Character'''<br />
|align="center"|'''Name'''<br />
|-<br />
|Top10/pT-TERM<br />
|So not express any repressors<br />
|align="center"|CR00<br />
|-<br />
|Top10/pT-ARL4A0604<br />
|Constitutively express ARL4A0604<br />
|align="center"|CR01<br />
|-<br />
|Top10/pT-ARL2A0203<br />
|Constitutively express ARL2A0203<br />
|align="center"|CR10<br />
|-<br />
|Top10/pTet-ARL4A0604-ARL2A203<br />
|Constitutively express ARL4A0604 and ARL2A0203<br />
|align="center"|CR11<br />
|}<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== Final Results ==<br />
<br />
{|<br />
| [[Image:USTC_BestNAND.png|thumb|200px|Best NAND]]<br />
| [[Image:USTC_BestNOR.png|thumb|200px|Best NOR]]<br />
| [[Image:USTC_BestNOT.png|thumb|200px|Best NOT]]<br />
|}<br />
<br />
<br />
=== Suggested Patterns ===<br />
[[Image:USTC_BestSchemes.png|thumb|right|300px|'''Figure 5''' Suggested patterns for NOT, NAND and NOR gates.]]<br />
<br />
'''NAND'''<BR><br />
A NAND Gate requires that two solo-repressions should be weak, and co-repression should be strong. We choose +83.5 to put the upstream operator, to avoid the uncertain activator regions. Another weak operator is put down at the +66.5 site. The relative distance between the two operators is 150, indicating a strong co-repression.<br />
<br />
'''NOR'''<BR><br />
We expected to find a NOR gate with two different operators around the conservative region of a promoter. But there is no available repressor binding site in the upstream of the conservative region based on the observed effect of operator positions. At present only the dual-repressed pattern works well as NOR gate, but it brings us a limitation in wires selecting when assembled into the whole system. <br />
<br />
'''NOT'''<BR><br />
The NOT gate is quite simple, containing only one operator of reverse symmetric structure at the +10.5 site.<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== References ==<br />
<br />
1. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J.; Kuhlman, T. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: applications.', <i>Curr Opin Genet Dev</i> 15(2), 125--135.<br />
<br />
2. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: models.', <i>Curr Opin Genet Dev</i> 15(2), 116--124.<br />
<br />
3. Buchler, N. E.; Gerland, U. & Hwa, T. (2003), 'On schemes of combinatorial transcription logic.', <i>PNAS</i> 100(9), 5136--5141.<br />
<br />
4. Davidson, E. H.; Rast, J. P.; Oliveri, P.; Ransick, A.; Calestani, C.; Yuh, C.; Minokawa, T.; Amore, G.; Hinman, V.; Arenas-Mena, C.; Otim, O.; Brown, C. T.; Livi, C. B.; Lee, P. Y.; Revilla, R.; Rust, A. G.; jun Pan, Z.; Schilstra, M. J.; Clarke, P. J. C.; Arnone, M. I.; Rowen, L.; Cameron, R. A.; McClay, D. R.; Hood, L. & Bolouri, H. (2002), A genomic regulatory network for development., <i>Science</i> 295(5560), 1669--1678.<br />
<br />
5. Elledge, S. J. & Davis, R. W. (1989), 'Position and density effects on repression by stationary and mobile DNA-binding proteins.', <i>Genes Dev</i> 3(2), 185--197.<br />
<br />
6. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
7. Lanzer, M. & Bujard, H. (1988), 'Promoters largely determine the efficiency of repressor action.', <i>PNAS</i> 85(23), 8973--8977.<br />
<br />
8. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328(6), 521--548.<br />
<br />
9. Rojo, F. (1999), 'Repression of transcription initiation in bacteria.', <i>J Bacteriol</i> 181(10), 2987--2991.<br />
<br />
10. Saiz, L. & Vilar, J. M. G. (2006), 'DNA looping: the consequences and its control.', <i>Curr Opin Struct Biol</i> 16(3), 344--350.<br />
<br />
11. Sheridan, S. D.; Opel, M. L. & Hatfield, G. W. (2001), 'Activation and repression of transcription initiation by a distant DNA structural transition.', <i>Mol Microbiol</i> 40(3), 684--690.<br />
<br />
12. [http://cnse.albany.edu/News/index.cfm?step=show_detail&NewsID=424 Semiconductor International: 45 to 32 nm: Another Evolutionary Transition.]<br />
<br />
<br />
<br></div>MaRuihttp://2007.igem.org/wiki/index.php/USTC/Logic-Gate_PromotersUSTC/Logic-Gate Promoters2007-10-26T15:03:22Z<p>MaRui: </p>
<hr />
<div>== Cis-acting Bio-Logic Gates ==<br />
<br />
In natural cells, combinational logic computation can be carried out by cis-acting elements [[USTC/Logic-Gate_Promoters#References|[4]]]. Theoretically, dual repressors interacting on two adjacent operators can generate complex logic function as NAND, NOT and NOT [[USTC/Logic-Gate_Promoters#References|[1,2,3]]]. However, seldom of the parameters of these models has been measured, and practical artificial logic promoters are hard to make because of the lack of appropriate inputs. In this project, we simplify these models to reduce the number of parameters, use artificial high-specific repressors based-on Lac repressor [[USTC/Logic-Gate_Promoters#References|[8]]] to serve as inputs, predict possible patterns of logic promoters, construct and test them experimentally, all to attempt to find a systematical way to construct cis-acting bio-logic promoters. As a result, a piece of DNA about 60 – 200bp is able to be built up and to act as a logic gate.<br />
<br />
<br />
=== Advatanges of Cis-acting Bio-Logic Gates ===<br />
# Work in vivo and can be genetically inherited<br />
# Can be systematically built up according to several patterns<br />
# Small in scale<br />
#* About 2.0nm in width, 20 - 70nm in length, similar to transistors in present VSLI in size [[USTC/Logic-Gate_Promoters#References|[12]]], sometimes even smaller<br />
# Can be cascaded to implement any complex combinational logic computation<br />
#* And is also able to form sequential circuit<br />
<br />
== Repression Model ==<br />
<br />
[[Image:USTC_RepressionModel.png|thumb|right|300px|'''Figure 1''' (a) Sketch map of solo-repression. (b) Sketch map of co-repression.]]<br />
<br />
Lacramioara Bintu et al. have reported a simple thermodynamic model which can quantify promoter activity under one or more regulatory factors [[USTC/Logic-Gate_Promoters#References|[1,2]]]. In this project, we focus on the multiple changes of promoter activity under the existence of one or two repressors. For a weak promoter, the multiple of its change can be approximately described as a function of different repressor concentrations, inter-operator distances, repressor–operator affinity and repressor-repressor interactions.<br />
<br />
For a promoter containing a single operator site shown in Figure 1(a), the promoter activity under <i>R</i> repressor molecules <i>A(R)</i> is:<br />
<br />
[[Image:USTC_RepressionModel_FC_Solo.png|center]]<br />
<br />
Note that <i>A(0)</i> is the promoter activity without repression; <i>&rho;(P)</i> is the solo-repression coefficient of the operator at the position <i>P</i>; <i>&Delta;&epsilon;(O)</i> is the difference of binding energy of operator <i>O</i> on specific sites to non-specific sites; <i>N<sub>NS</sub></i> is the number of non-specific sites; and <i>K<sub>B</sub></i> means the Boltzmann constant, <i>T</i> is the temperature.<br />
<br />
For a promoter containing two different operators, of which the relative repressors may be able to interact with each other shown in Figure 1(b), the promoter activity under combinations of two repressors, R<sub>A</sub> and R<sub>B</sub>, is given as:<br />
<br />
[[Image:USTC_RepressionModel_FC_Co.png|center]]<br />
<br />
Where <i>&omega;(P<sub>A</sub>, P<sub>B</sub>)</i> is the co-repression coefficient when O<sub>A</sub> is located at <i>P<sub>A</sub></i>, and O<sub>B</sub> at <i>P<sub>B</sub></i>.<br />
<br />
Concerning a NOT gate which works under approximately equal high or low repressor concentration, R<sub>low</sub>=0 and R<sub>high</sub>=R<sub>H</sub>, we assessed its performance by giving it a score:<br />
<br />
[[Image:USTC_RepressionModel_NOT_Score.png|center]]<br />
<br />
In the same way, NAND score and NOR score are:<br />
<br />
[[Image:USTC_RepressionModel_NAND_Score.png|center]]<br />
<br />
[[Image:USTC_RepressionModel_NOR_Score.png|center]]<br />
<br />
In the situation with a fixed combination of two repressors, R<sub>A</sub> and R<sub>B</sub>, and approximately equal high or low repressor concentration, the logic performance of a promoter is a function of inter-operator distances, repressor–operator affinity and repressor-repressor interactions. By adjusting these parameters, it is possible to find out well-performing bio-logic promoters.<br />
<br />
== Schemes of Bio-Logic Promoters ==<br />
<br />
Dozens of potential bio-logic patterns were experimentally synthesized and tested in solo-repression or co-repression test-bench. Some representative ones are shown and commented as following.<br />
<br />
{| border="1"<br />
|-<br />
|align="center"| '''Scheme'''<br />
|align="center"| '''Test-environment'''<br />
|align="center"| '''Results'''<br />
|align="center"| '''Comments'''<br />
|-<br />
| [[Image:USTC_NANDv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI_LRLa.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data.png|93px]]<br />
| [[USTC/Interference between LacI and LRLa|Interference between inputs]]<br />
|-<br />
| [[Image:USTC_NOTv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_LacI.png|64px]]<br />
|align="center"| [[Image:USTC_NOTv1_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NANDv2a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv2a_Data.png|93px]]<br />
| <font color="orange">Works</font><BR>[[USTC/OperatorPosition|But with slight downstream repression]]<br />
|-<br />
| [[Image:USTC_NANDv2b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[USTC/FailureOfNANDv2b|Failed in<BR>X-gal Assay]]<br />
| [[USTC/OperatorComposition|"Ox7" kind of operators are too weak]]<br />
|-<br />
| [[Image:USTC_NORv1.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv1_Data2.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv3a.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3a_Data.png|93px]]<br />
| [[USTC/InterOperatorDistance|Co-repression is too weak]]<BR>[[USTC/OperatorPosition|Downstream solo-repression is to strong]]<br />
|-<br />
| [[Image:USTC_NANDv3b.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv3b_Data.png|93px]]<br />
| <font color="red">Works</font><br />
|-<br />
| [[Image:USTC_NORv2.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NORv2_Data.png|93px]]<br />
| [[USTC/OperatorPosition|Inefficacy of upstream operator]]<br />
|-<br />
| [[Image:USTC_NANDv4.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_ARL2A0203.png|92px]]<br />
|align="center"| [[Image:USTC_NANDv4_Data.png|93px]]<br />
| [[USTC/HybridOperator|Hybrid operator do not work as expected]]<br />
|-<br />
| [[Image:USTC_NORv3.png|380px]]<br />
|align="center"| [[Image:USTC_RM_ARL4A0604_LacI.png|92px]]<br />
|align="center"| [[Image:USTC_NORv3_Data.png|93px]]<br />
| <font color="red">Works</font><BR>[[USTC/CoRepressedOperator|With a request of co-operator]]<br />
|-<br />
|}<br />
<br />
<br />
<br />
== Valuable Experiences for Bio-Logic Promoters ==<br />
<br />
=== Factors of Gate-Performances === <br />
The level of repression in vivo is determined by several factors . Because both 'strong' operator and 'weak' operator are required for our system, we systematically tested the effects by the two primary factors: [[USTC/OperatorComposition|'''composition''']] and [[USTC/OperatorPosition|'''position''']].The proper distance between two operators is also necessary for NOR and NAND gates, and data has been [[USTC/InterOperatorDistance|'''reported''']].<br />
<br />
=== Hybrid Operator and Dual-Repressed Operator ===<br />
Based on the data of [[USTC/OperatorComposition|'''operators' composition''']], two ideas has been proposed and attempted to realize:<br />
* [[USTC/HybridOperator|'''Crossbreeding two specific operators''']] may carry out new functions.<br />
* A specific operator repressed by two or more different repressors can be used as [[USTC/DualRepressedOperator|'''a model for NOR gate''']].<br />
<br />
<br />
<br />
<br />
<br />
== Repression Assay ==<br />
=== Build Up Promoter Family ===<br />
<br />
[[Image:USTC_PCRBuilding.png|thumb|400px|right|'''Figure ''' PCR Building]]<br />
<br />
Firstly, we extend both sides of the conservative region for transcriptional initiation [[USTC/Logic-Gate_Promoters#References|[9]]] of PlacUV5 [[USTC/Logic-Gate_Promoters#References|[7]]], including -35 box,-10 box and +1 starting point, with two non-sense sequence selected from random groups. The product is named as P_template1 as it is the template for the promoter family. These two non-sense sequence have three main characters:<br />
# They will never include the restriction enzyme cutting sites that will be involved in the whole study;<br />
# They will never include the recognition sites of RNA Polymerases and those of either of the two repressors;<br />
# They will never present in complicated structures.<br />
<br />
Secondly, another group of primers, of which the elongation region at 5’ end may contain a unique operator sequence or each, is applied at both ends of P_template1, equipping us with an according group of promoters with complete structures. These promoters can include variant operator sequences at different position in flank of the conservative region.<br />
<br />
Then the promoter fragments are digested with XbaI and BamHI and loaded into repression-reporter plasmid, which contains <i>lacZ</i> alpha fragment and <i>gfp</i> under the promoter insertion site.<br />
<br />
All the members of the our promoter family are named according to [[USTC/NamingRules|'''a uniform rule''']].<br />
<br />
<br />
=== Solo-Repression Assay ===<br />
<br />
[[Image:SoloRepressionAssay.png|thumb|right|400px|'''Figure''' Solo-Repression]]<br />
<br />
Two plasmids are used in solo-repression assay. First, a plasmid constitutively expressing a specific repressor is transformed into Top10. Then the promoters to be tested, which contain variant operator compositions and positions, are transformed into the strains got in the first step and then selected through double resistance.<br />
<br />
<BR clear="both"><br />
<br />
=== Co-Repression Assay ===<br />
<br />
Promoters to be tested are loaded into double-reporter plasmid and then transformed into the four test strains (CR00, CR01, CR10, CR11). By reading the color of the colonies on plates with X-Gal, and by testing the fluorescence intensity under a fluorescence microscope, we can get the solo-repression and co-repression effects of the two repressors on specific promoters. <br />
[[Image:USTC_CoRepressionAssay.png|thumb|300px|'''Figure''' Co-Repression Assay]]<br />
<br />
{| border="1"<br />
|-<br />
|align="center"|'''Genotype'''<br />
|align="center"|'''Character'''<br />
|align="center"|'''Name'''<br />
|-<br />
|Top10/pT-TERM<br />
|So not express any repressors<br />
|align="center"|CR00<br />
|-<br />
|Top10/pT-ARL4A0604<br />
|Constitutively express ARL4A0604<br />
|align="center"|CR01<br />
|-<br />
|Top10/pT-ARL2A0203<br />
|Constitutively express ARL2A0203<br />
|align="center"|CR10<br />
|-<br />
|Top10/pTet-ARL4A0604-ARL2A203<br />
|Constitutively express ARL4A0604 and ARL2A0203<br />
|align="center"|CR11<br />
|}<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== Final Results ==<br />
<br />
{|<br />
| [[Image:USTC_BestNAND.png|thumb|200px|Best NAND]]<br />
| [[Image:USTC_BestNOR.png|thumb|200px|Best NOR]]<br />
| [[Image:USTC_BestNOT.png|thumb|200px|Best NOT]]<br />
|}<br />
<br />
<br />
=== Suggested Patterns ===<br />
[[Image:USTC_BestSchemes.png|thumb|right|300px|'''Figure 5''' Suggested patterns for NOT, NAND and NOR gates.]]<br />
<br />
'''NAND'''<BR><br />
A NAND Gate requires that two solo-repressions should be weak, and co-repression should be strong. We choose +83.5 to put the upstream operator, to avoid the uncertain activator regions. Another weak operator is put down at the +66.5 site. The relative distance between the two operators is 150, indicating a strong co-repression.<br />
<br />
'''NOR'''<BR><br />
We expected to find a NOR gate with two different operators around the conservative region of a promoter. But there is no available repressor binding site in the upstream of the conservative region based on the observed effect of operator positions. At present only the dual-repressed pattern works well as NOR gate, but it brings us a limitation in wires selecting when assembled into the whole system. <br />
<br />
'''NOT'''<BR><br />
The NOT gate is quite simple, containing only one operator of reverse symmetric structure at the +10.5 site.<br />
<br />
<BR clear="both"><br />
<br />
----<br />
<br />
== References ==<br />
<br />
1. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J.; Kuhlman, T. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: applications.', <i>Curr Opin Genet Dev</i> 15(2), 125--135.<br />
<br />
2. Bintu, L.; Buchler, N. E.; Garcia, H. G.; Gerland, U.; Hwa, T.; Kondev, J. & Phillips, R. (2005), 'Transcriptional regulation by the numbers: models.', <i>Curr Opin Genet Dev</i> 15(2), 116--124.<br />
<br />
3. Buchler, N. E.; Gerland, U. & Hwa, T. (2003), 'On schemes of combinatorial transcription logic.', <i>PNAS</i> 100(9), 5136--5141.<br />
<br />
4. Davidson, E. H.; Rast, J. P.; Oliveri, P.; Ransick, A.; Calestani, C.; Yuh, C.; Minokawa, T.; Amore, G.; Hinman, V.; Arenas-Mena, C.; Otim, O.; Brown, C. T.; Livi, C. B.; Lee, P. Y.; Revilla, R.; Rust, A. G.; jun Pan, Z.; Schilstra, M. J.; Clarke, P. J. C.; Arnone, M. I.; Rowen, L.; Cameron, R. A.; McClay, D. R.; Hood, L. & Bolouri, H. (2002), A genomic regulatory network for development., <i>Science</i> 295(5560), 1669--1678.<br />
<br />
5. Elledge, S. J. & Davis, R. W. (1989), 'Position and density effects on repression by stationary and mobile DNA-binding proteins.', <i>Genes Dev</i> 3(2), 185--197.<br />
<br />
6. Kalodimos, C. G.; Bonvin, A. M. J. J.; Salinas, R. K.; Wechselberger, R.; Boelens, R. & Kaptein, R. (2002), 'Plasticity in protein-DNA recognition: lac repressor interacts with its natural operator 01 through alternative conformations of its DNA-binding domain.', <i>EMBO J</i> 21(12), 2866--2876.<br />
<br />
7. Lanzer, M. & Bujard, H. (1988), 'Promoters largely determine the efficiency of repressor action.', <i>PNAS</i> 85(23), 8973--8977.<br />
<br />
8. Lewis, M. (2005), 'The lac repressor.', <i>C R Biol</i> 328(6), 521--548.<br />
<br />
9. Rojo, F. (1999), 'Repression of transcription initiation in bacteria.', <i>J Bacteriol</i> 181(10), 2987--2991.<br />
<br />
10. Saiz, L. & Vilar, J. M. G. (2006), 'DNA looping: the consequences and its control.', <i>Curr Opin Struct Biol</i> 16(3), 344--350.<br />
<br />
11. Sheridan, S. D.; Opel, M. L. & Hatfield, G. W. (2001), 'Activation and repression of transcription initiation by a distant DNA structural transition.', <i>Mol Microbiol</i> 40(3), 684--690.<br />
<br />
12. [http://cnse.albany.edu/News/index.cfm?step=show_detail&NewsID=424 Semiconductor International: 45 to 32 nm: Another Evolutionary Transition.]<br />
<br />
<br />
<br></div>MaRui