http://2007.igem.org/wiki/index.php?title=Special:Contributions/Vhouston&feed=atom&limit=50&target=Vhouston&year=&month=2007.igem.org - User contributions [en]2024-03-28T15:49:35ZFrom 2007.igem.orgMediaWiki 1.16.5http://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T22:50:18Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement. Each fuel was burned at a stoichiometric air to fuel ratio at 4 different angular speeds. The experimental setup and results can be seen below.<br />
<br />
[[image: alberta_engine1.jpeg|thumb|left|275px| Engine Test Setup Front View]]<br />
[[image: alberta_engine2.jpeg|thumb|left|275px| Engine Test Setup Side View]]<br />
[[image: alberta_enginechart2.jpeg|thumb|left|275px| Peak Power vs. RPM Experimental Data]]<br />
<br><br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomass into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' (i.e. endogenous butanoate pathway) into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
I: Transforming genes in ''C. acetobutylicum'''s butanoate pathway into ''E.coli''<br><br />
Genes encoding the enzymes in the ''C. acetobutylicum'' butanoate metabolism pathway were identified using the KEGG database (KEGG number-ca00650: http://www.kegg.com/dbget-bin/www_bget?path:cac00650). Our cloning stragegy is to incorporate all the genes in a single operon with respective inducible promoter and ribosome binding site in a plasmid. Such construct enables easy transformation of multiple genes simultaneously into ''E.coli'' and allows the coordinated expression of genes within the operon. <br><br />
<br />
After receiving the commercially synthesized coding sequences of the genes of interest, the coding sequences are restricted with proper BioBrick prefixes and suffixes out of the original plasmid and cloned into B0034 (ribosome binding site). Double digest (Xba I and Spe I) as well as automated sequencing reactions were performed to verify the proper insertion of the coding sequences and the presence of a ribosome binding site at the 5' end of each coding sequence. <br><br />
<br />
The operon, shown below, consists of all of the genes in the pathway (except ''E. coli'''sthiolase). Note that we purposedly added a Histamine tag to the carboxy terminus of each gene product such that we could use Nickel-NTA column to purify the individual proteins and analyze protein expression and activity.<br />
[[image: alberta_butanol_Operon.jpeg|thumb|center|400px|The Butanol Operon]]<br />
<br />
Objective 2: Develop Butanol Tolerance with mutagenic and toxic compound Ethylnitrosourea ENU.<br><br />
The concept is to make butanol agar plates of various butanol concentrations and place an ENU disk in the centre. We expect there will be two kill zones. The first where bacteria die due to the toxicity of ENU at the centre of the plate. The second around the outer ring of the butanol plate where bacteria die due to butanol toxicity. In between these two zones we hope to see some cells that would be mutated in a benifical way to allow them to survive in the butanol.<br />
<br />
[[image: alberta_butanolplate2.jpeg|400px|thumb|center|Proposed Butanol-ENU Plate for Mutagenisis of ''E. coli'']]<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to [[http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html ''here'']]. Images below from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
[[image: alberta_carboncycle1.jpeg|thumb|300px|center| Propose Closed Carbon-butanol Cycle]]<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered three factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''. <br><br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
The GANTT Chart Above details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: ''' <br><br />
Benny - Butyryl CoA dehydrogenase<br><br />
Enny - Enoyl CoA hydratase<br><br />
Buddy - Butanol dehydrogenase<br><br />
Betty - Beta-hydraoxy butyryl CoA dehydrogenase<br><br />
Deisel Blaze - Butyraldehyde dehydrogenase<br><br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T22:44:35Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement. Each fuel was burned at a stoichiometric air to fuel ratio at 4 different angular speeds. The experimental setup and results can be seen below.<br />
<br />
[[image: alberta_engine1.jpeg|thumb|left|275px| Engine Test Setup Front View]]<br />
[[image: alberta_engine2.jpeg|thumb|left|275px| Engine Test Setup Side View]]<br />
[[image: alberta_enginechart2.jpeg|thumb|left|275px| Peak Power vs. RPM Experimental Data]]<br />
<br><br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomass into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' (i.e. endogenous butanoate pathway) into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
I: Transforming genes in ''C. acetobutylicum'''s butanoate pathway into ''E.coli''<br><br />
Genes encoding the enzymes in the ''C. acetobutylicum'' butanoate metabolism pathway were identified using the KEGG database (KEGG number-ca00650: http://www.kegg.com/dbget-bin/www_bget?path:cac00650). Our cloning stragegy is to incorporate all the genes in a single operon with respective inducible promoter and ribosome binding site in a plasmid. Such construct enables easy transformation of multiple genes simultaneously into ''E.coli'' and allows the coordinated expression of genes within the operon. <br><br />
<br />
After receiving the commercially synthesized coding sequences of the genes of interest, the coding sequences are restricted with proper BioBrick prefixes and suffixes out of the original plasmid and cloned into B0034 (ribosome binding site). Double digest (Xba I and Spe I) as well as automated sequencing reactions were performed to verify the proper insertion of the coding sequences and the presence of a ribosome binding site at the 5' end of each coding sequence. <br><br />
<br />
The operon, shown below, consists of all of the genes in the pathway (except ''E. coli'''sthiolase). Note that we purposedly added a Histamine tag to the carboxy terminus of each gene product such that we could use Nickel-NTA column to purify the individual proteins and analyze protein expression and activity.<br />
[[image: alberta_butanol_Operon.jpeg|thumb|center|400px|The Butanol Operon]]<br />
<br />
Objective 2: Develop Butanol Tolerance with mutagenic and toxic compound Ethylnitrosourea ENU.<br><br />
The concept is to make butanol agar plates of various butanol concentrations and place an ENU disk in the centre. We expect there will be two kill zones. The first where bacteria die due to the toxicity of ENU at the centre of the plate. The second around the outer ring of the butanol plate where bacteria die due to butanol toxicity. In between these two zones we hope to see some cells that would be mutated in a benifical way to allow them to survive in the butanol.<br />
<br />
[[image: alberta_butanolplate2.jpeg|400px|thumb|center|Proposed Butanol-ENU Plate for Mutagenisis of ''E. coli'']]<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to [[http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html ''here'']]. Images below from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
[[image: alberta_carboncycle1.jpeg|thumb|300px|center| Propose Closed Carbon-butanol Cycle]]<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered three factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''. <br><br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
The GANTT Chart Above details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: ''' <br><br />
Benny - Butaryl CoA DH<br><br />
Enny - Enoyl CoA hydratase<br><br />
Buddy - Butanal DH<br><br />
Betty - B hydraoxy butyryl CoA DH<br><br />
Deisel Blaze - Buteraldehyde dehydrogenase<br><br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T22:43:32Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement. Each fuel was burned at a stoichiometric air to fuel ratio at 4 different angular speeds. The experimental setup and results can be seen below.<br />
<br />
[[image: alberta_engine1.jpeg|thumb|left|275px| Engine Test Setup Front View]]<br />
[[image: alberta_engine2.jpeg|thumb|left|275px| Engine Test Setup Side View]]<br />
[[image: alberta_enginechart2.jpeg|thumb|left|275px| Peak Power vs. RPM Experimental Data]]<br />
<br><br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomass into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' (i.e. endogenous butanoate pathway) into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
I: Transforming genes in ''C. acetobutylicum'''s butanoate pathway into ''E.coli''<br><br />
Genes encoding the enzymes in the ''C. acetobutylicum'' butanoate metabolism pathway were identified using the KEGG database (KEGG number-ca00650: http://www.kegg.com/dbget-bin/www_bget?path:cac00650). Our cloning stragegy is to incorporate all the genes in a single operon with respective inducible promoter and ribosome binding site in a plasmid. Such construct enables easy transformation of multiple genes simultaneously into ''E.coli'' and allows the coordinated expression of genes within the operon. <br><br />
<br />
After receiving the commercially synthesized coding sequences of the genes of interest, the coding sequences are restricted with proper BioBrick prefixes and suffixes out of the original plasmid and cloned into B0034 (ribosome binding site). Double digest (Xba I and Spe I) as well as automated sequencing reactions were performed to verify the proper insertion of the coding sequences and the presence of a ribosome binding site at the 5' end of each coding sequence. <br><br />
<br />
The operon, shown below, consists of all of the genes in the pathway (except ''E. coli'''sthiolase). Note that we purposedly added a Histamine tag to the carboxy terminus of each gene product such that we could use Nickel-NTA column to purify the individual proteins and analyze protein expression and activity.<br />
[[image: alberta_butanol_Operon.jpeg|thumb|center|400px|The Butanol Operon]]<br />
<br />
Objective 2: Develop Butanol Tolerance with mutagenic and toxic compound Ethylnitrosourea ENU.<br><br />
The concept is to make butanol agar plates of various butanol concentrations and place an ENU disk in the centre. We expect there will be two kill zones. The first where bacteria die due to the toxicity of ENU at the centre of the plate. The second around the outer ring of the butanol plate where bacteria die due to butanol toxicity. In between these two zones we hope to see some cells that would be mutated in a benifical way to allow them to survive in the butanol.<br />
<br />
[[image: alberta_butanolplate2.jpeg|400px|thumb|center|Proposed Butanol-ENU Plate for Mutagenisis of ''E. coli'']]<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to [[http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html ''here'']]. Images below from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
[[image: alberta_carboncycle1.jpeg|thumb|300px|center| Propose Closed Carbon-butanol Cycle]]<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered three factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''. <br><br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
The GANTT Chart Above details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: ''' <br><br />
Benny - Butaryl CoA DH<br><br />
Enny - Enoyl CoA - hydratase<br><br />
Buddy - Butanal DH<br><br />
Betty - B hydraoxy butyryl CoA DH<br><br />
Deisel Blaze - Buteraldehyde dehydrogenase<br><br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T16:15:15Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement.<br />
<br />
<br />
<br />
<br />
Butanol produced slightly more power and a slightly high thermodynamic efficincy that Iso-Octane. More information can be found '''[[Alberta/Engine_Test|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
The GANTT Chart below details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: ''' <br><br />
Benny - <br><br />
Enny - <br><br />
Buddy - <br><br />
Betty - <br><br />
Deisel Blaze - <br><br />
J61003 - <br><br />
B0034 - <br><br />
I0500 - <br><br />
Thiolase - <br><br />
BBDBE - Combination of genes in order of ...<br><br />
BEDBB - Combination of genes in order of ...<br><br />
DBEBB - Combination of genes in order of ...<br><br />
DBBBE - Combination of genes in order of ...<br><br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered two factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''.<br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T16:14:33Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement.<br />
<br />
<br />
<br />
<br />
Butanol produced slightly more power and a slightly high thermodynamic efficincy that Iso-Octane. More information can be found '''[[Alberta/Engine_Test|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
The GANTT Chart below details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: '''<br />
Benny - <br><br />
Enny - <br />
Buddy - <br />
Betty - <br />
Deisel Blaze - <br />
J61003 - <br />
<br />
B0034 - <br />
<br />
I0500 - <br />
<br />
Thiolase - <br />
<br />
BBDBE - Combination of genes in order of ...<br />
<br />
BEDBB - Combination of genes in order of ...<br />
<br />
DBEBB - Combination of genes in order of ...<br />
<br />
DBBBE - Combination of genes in order of ...<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered two factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''.<br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T16:14:11Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement.<br />
<br />
<br />
<br />
<br />
Butanol produced slightly more power and a slightly high thermodynamic efficincy that Iso-Octane. More information can be found '''[[Alberta/Engine_Test|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
The GANTT Chart below details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: '''<br />
Benny - <br />
Enny - <br />
Buddy - <br />
Betty - <br />
Deisel Blaze - <br />
J61003 - <br />
<br />
B0034 - <br />
<br />
I0500 - <br />
<br />
Thiolase - <br />
<br />
BBDBE - Combination of genes in order of ...<br />
<br />
BEDBB - Combination of genes in order of ...<br />
<br />
DBEBB - Combination of genes in order of ...<br />
<br />
DBBBE - Combination of genes in order of ...<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered two factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''.<br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T16:13:43Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement.<br />
<br />
<br />
<br />
<br />
Butanol produced slightly more power and a slightly high thermodynamic efficincy that Iso-Octane. More information can be found '''[[Alberta/Engine_Test|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
The GANTT Chart below details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
'''Legend: '''<br />
<br />
Benny - <br />
<br />
Enny - <br />
<br />
Buddy - <br />
<br />
Betty - <br />
<br />
Deisel Blaze - <br />
<br />
J61003 - <br />
<br />
B0034 - <br />
<br />
I0500 - <br />
<br />
Thiolase - <br />
<br />
BBDBE - Combination of genes in order of ...<br />
<br />
BEDBB - Combination of genes in order of ...<br />
<br />
DBEBB - Combination of genes in order of ...<br />
<br />
DBBBE - Combination of genes in order of ...<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered two factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''.<br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-26T16:12:22Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns of global greenhouse gasses, the global energy market is in a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. Secondly, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuel source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, organic pollution standards. Blending butanol with gasoline also prevents major modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns as well as offering the possiblity of phase separation which would realize huge cost savings in terms of production.<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
The Butanerds wanted to further evaluate the use of butanol as a fuel in standard spark ignition engines. With the assistance of The University of Alberta's Engine Control Lab in Mechanical Engineering we were able to run a peak power test comparing butanol to iso-octane, a standard test measurement.<br />
<br />
<br />
<br />
<br />
Butanol produced slightly more power and a slightly high thermodynamic efficincy that Iso-Octane. More information can be found '''[[Alberta/Engine_Test|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''Escherichia coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production from ''Clostridium acetobutylicum'' into ''E. coli''. Furthermore, we hope to increase ''E. coli'''s tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are investigating the use of a photoautotrophic bacterium, ''Chlorobium tepidum'' that we will also introduce butanol producing genes to. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees Celsius (104 degrees Fahrenheit), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input and output. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
The GANTT Chart below details the schedule for the lab work that contributed to Plan B. Beginning in July and finishing with our final work in October, the schedule includes details on our different methods to compose an operon that would meet our objectives. In order to read the GANTT Chart for the Lab work of Plan B, please refer to the legend below.<br />
<br />
Legend: <br />
<br />
Benny - <br />
<br />
Enny - <br />
<br />
Buddy - <br />
<br />
Betty - <br />
<br />
Deisel Blaze - <br />
<br />
J61003 - <br />
<br />
B0034 - <br />
<br />
I0500 - <br />
<br />
Thiolase - <br />
<br />
BBDBE - Combination of genes in order of ...<br />
<br />
BEDBB - Combination of genes in order of ...<br />
<br />
DBEBB - Combination of genes in order of ...<br />
<br />
DBBBE - Combination of genes in order of ...<br />
<br />
[[image: Alberta_gantt.jpeg|thumb|400px|center|[[Project Gantt Chart (click here to enlarge)]]]]<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team_new.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
== '''Edmonton''' ==<br />
<br />
Welcome to Edmonton!<br />
<br />
<center>[[Image: Alberta_edmonton.jpg]]</center><br />
<br><br />
<br />
For more on the city of Edmonton click '''[http://www.ualberta.ca/~mjl3/About.html here]'''.<br />
<br />
== '''Modeling Efforts''' ==<br />
<br />
Initially our plan to model the efficiency of the butanol production hinged on developing a complete model for the entire glucose pathway in an ''E. coli'' cell using Michaelis-Menten kinetics. After further review, this proved to be beyond the scope of our project's timeline due both to the large number of species and reactions present in the system (as well as their non-linear behavior) and the relative difficulty in finding experimental kinetic information for some of the reactions in our pathway. <br> <br />
<br />
<br />
Therefore, to obtain a rough "first-order" approximation for the behavior of the pathway, we considered two factors:<br />
<br />
1) Stoichiometric factors (both redox and carbon)<br><br />
2) Compared the relative production rates of the various end products of the glucose pathway in ''E. coli'' as found in previous experimentation to the production rates of butanol in ''C. acetobutylicum''.<br />
3) We have also a fuel E. coli Stoichometric Matrix, and intend to stoichiometrically model the system in order to optimize butanol production once the operon is in the system.<br />
<br />
<br />
From these factors we can obtain an indicator of how likely butanol will be produced.<br />
<br><br />
<br />
In order to further develop the system, we hope a full metabolic stochiometric model can be eventually realized for this project. This would allow optimization of the system in order to maximize the flux through the butanol pathway.<br />
<br />
== '''Sponsors''' ==<br />
<br />
We would like to thank all of our sponsers for their gracious support and our advisors for invaluble advise.<br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors1.gif]]<br />
|}<br />
<br />
<br />
'''Sponsors'''<br />
<br />
{| align="center" style="color:white;"<br />
|[[Image: Alberta_sponsors2.gif]]<br />
|}<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta''<br><br />
'''Dr. David Bressler''' - ''University of Alberta''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta''<br><br />
'''Dr. Federick West'''-''University of Alberta''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
'''Dr. David Checkel''' - ''University of Alberta''<br><br />
'''Adrian Audiet''' - ''University of Alberta''<br><br />
'''Dr. Koch''' - ''University of Alberta''<br><br />
'''Dr. Donald Bryant''' - ''Pennsylvania State''<br><br />
'''Dr. Gaozhong Shen''' - ''Pennsylvania State''<br><br />
'''Amaya Garcia''' - ''Pennsylvania State''<br><br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''External Links''' ==<br />
<br />
[http://www.albertaingenuity.ca/ Alberta Ingenuity Fund]<br />
<br />
[http://www.ualberta.ca The University of Alberta Hompage]<br />
<br />
[http://www.mece.ualberta.ca/~ckoch/ Dr. Koch's Engine Lab]<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:45:03Z<p>Vhouston: /* October 23 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
<br />
-Ran a gel of restriction<br />
<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
ML - Gel purified Boo-Thiolase<br />
<br />
-Digested B0034 with ECO and PST<br />
<br />
-Ligated Thiolase with B0034<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
AL and NK - Transformed B0034 and Thiolase into XL10 Gold Cells.<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:44:05Z<p>Vhouston: /* October 22 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
<br />
-Ran a gel of restriction<br />
<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
ML - Gel purified Boo-Thiolase<br />
<br />
-Digested B0034 with ECO and PST<br />
<br />
-Ligated Thiolase with B0034<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:43:43Z<p>Vhouston: /* October 16 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
<br />
-Ran a gel of restriction<br />
<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
ML - Gel purified Boo-Thiolase<br />
-Digested B0034 with ECO and PST<br />
-Ligated Thiolase with B0034<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:43:12Z<p>Vhouston: /* October 22 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
-Ran a gel of restriction<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
ML - Gel purified Boo-Thiolase<br />
-Digested B0034 with ECO and PST<br />
-Ligated Thiolase with B0034<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:41:03Z<p>Vhouston: /* October 18 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
-Ran a gel of restriction<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:40:50Z<p>Vhouston: /* October 17 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
-Ran a gel of restriction<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:39:59Z<p>Vhouston: /* October 17 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
-Ran a gel of restriction<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
VH - Transformed B0034, Buddy ligations from yesterday and plated them on Amp plates<br />
<br />
<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-24T23:38:22Z<p>Vhouston: /* October 16 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
JG<br><br />
Miniprep J61003+Enny and Benny+J61003<br><br />
Minis are in -20<br><br><br />
ML<br><br />
Brought the tubes labelled "sequencing rxns" up to MBSU<br><br />
Also brought some XBA 1 from fermentas freezer since we ran out<br><br />
Digests JG's miniprep with Xbal and PST. Ran out of out of XBA during digests, which meant that EJ 4,5,6only digested with XBA for 35 min<br><br />
Colony O/N of I0500/ J61003 and Buddy/J61003<br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br><br />
No Kan plates therefore made kan plates<br><br />
On COuntertop<br><br />
Miniprepped ML's overnights from OCt 1<br><br />
Lysis solution is a no go<br><br />
Started new O/N of previows overnights for tomorrow<br><br />
No more LB<br><br />
<br />
WM is Wayne Materi (a team advisor) in the following.<br />
<br />
WM-<br />
Assembling all the individual genes into an operon in order of their role in the butanoate pathway from KEGG.<br />
We will start with I725021 (RBS + B-hydroxy butyryl coA dehydrogenase in the B0034 plasmid - pSB1A2)then insert I725022 (RBS + Enoyl-coa hydratase), then I725023 (RBS + Butyryl coa Dehydrogenase), then I725024 (RBS + Butyraldehyde dehydrogenase), and finally I725025 (RBS + Butanol dehydrogenase). After the operon is constructed and verified, we will insert the Arabinose promoter from I0500 5' to all the genes.<br />
<br />
Digest I725021/SpeI+PstI and gel purify ~3kb band<br />
Digest I725022/SpeI+PstI and gel purify ~1.2kb band<br />
<br />
Ligate (Got 16 colonies vs. 10 for negative ctl).<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
Autoclaved 2 bottosl of Ependorf tupes- to be picked up from G308<br><br />
Transform THolase into XL10 gold plates<br><br />
Miniprep of 10500+J61003 O/N<br><br />
<br />
ML<br><br />
Digest of 10500+J61003 with ECORI and XBA<br><br />
Housekeeping complete<br><br />
Note to Justin: Samples to sequence are in -20 labelled "Justin! Sequence me"<br><br />
CZ - 7:00pm<br><br />
Ran gel of I0500/J61003<br><br />
It looks like I05oo is in J61003 but have to confirm with Justin or Michelle or Erin. <br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br><br />
Cleaned up 37 degree<br><br />
Moved 30th plates of I0500+JG and Buddy+j6 to 4 degree fridge<br><br />
Disposed of really disgusting plates<br><br />
Got ride of I0500 ovrnights that hve been on shaker for a wek now<br><br />
CHecke thoolase kan plates<br><br />
Showing blue dots so far and af we white doets<br><br />
Left plates in 37 celsious room<br><br><br />
JP<br><br />
Sequencing of 3 primer of DBS<br><br />
Ligate I0500 eco/spe into J61003 (eco/xba)<br><br />
<br />
<br />
WM - Primers for colony PCR and sequencing are as follows: <br><br />
Primer 1 (3' end of I725021) CTGGTTGGCTGGGTCGTAAATCC <br><br />
Primer 2 (3' end of I725022) GACGCTATGACCGCTTTCATCG <br><br />
Primer 3 (3' end of I725023) CTACGAAGGTACCTCCGAAGTTC <br><br />
Primer 4 (3' end of I725024) CGCTGATCTCCGAACTGAAAGAC <br><br />
Primer 5 (3' end of I725025) CTGCGTCCGGTTAACGCTTCC <br><br />
VF and VR as per BioBricks <br><br />
<br><br />
Performed Colony PCR on 10 candidates for BuOP1 (I725021 + I725022) using Primer1 and VR (expect 1063 bp band if good) <br><br />
<br><br />
Expect <br />
[[Image:UVP00153annot.jpg]]<br><br />
<br><br />
Colonies 1 and 8 look good. Sequence with Primer 1. <br><br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
JG/MC - 800hrs <br><br />
Ran gel of i0500 and buddy<br><br />
Digest #4 J61003/I0500 Digest Eco/xba with Pst to drop out of GFP<br><br />
Ran gel of I0500J61003 eco/xba<br><br><br />
ML<br><br />
Gel completd and took photos<br><br />
Buddy and I0500 digested<br><br />
Extracted gel<br><br />
Labelled I0500 purify Oct5 and Buddy Purify oct 5<br><br><br />
<br />
<br />
CZ - Sorry I can't make it for personal reasons.<br />
<br />
WM - BuOP1.1 and BuOP1.8 both sequenced good from nt 1096 to 1816.<br />
<br />
Also ran a verifying digest on BuOP1 O/Ns <br />
<br />
BuOP1/XbaI + SpeI (expect 2149 and 1709 bp if good)<br />
<br />
[[Image:UVP00157annot.jpg]]<br />
<br />
BuOP1.1 and .8 both look good.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
Made a to do list for the day<br><br />
<br />
NK 2pm<br><br />
Ligations of I0500 purify oct 5 and J61003<br><br />
Left on bench with green tape labelled "ligations oct6"<br><br />
Digest Boo34 with s,p<br><br />
Digests in freezer labelled "digestions B0034 S,P"<br><br />
<br />
WM - Make BuOP2 by inserting I725023 into BuOP1<br />
<br />
Digests: BuOP1/SpeI+PstI (gel purify ~3.8kb band) <br />
I725023/XbaI+PstI (gel purify ~850bp band - already have)<br />
<br />
[[Image:UVP00158annot.jpg]]<br />
<br />
Cutout, bands, quantitated DNA and ligated -> Plate 150 ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
NG 12:00<br />
<br />
WM - did 8 O/Ns and minipreps<br />
<br />
Verify with XbaI+SpeI digest (expect 2149+2916bp bands if good)<br />
<br />
[[Image:UVP00160annot.jpg]]<br />
<br />
All but 4 and 8 look good. Sequence BuOP2.1, 2.2, 2.5, 2.6 with Primer 2<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
WM - BuOP2.1, 2.2, 2.5, 2.6 all sequenced good.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
NK<br><br />
Loaded gel with digets from october 6, boo34 S,P<br><br />
Put the ligations from oct6 in the freezer with the tape in tray #3<br><br />
<br />
VH<br><br />
Gel extrations B0034 sp1 and boo34 sp2<br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
JP?<br><br />
Tholase PCR<br><br><br />
MC<br><br />
Ligated Buddy oct 5 into Boo34 digest oct 6<br><br />
Left on bench<br><br />
<br />
WM - Make BuOP3 by inserting I725024 into BuOP2<br />
<br />
Digests: BuOP2/SpeI+PstI (expect 5047bp -> gel purify)<br />
I725024/XbaI+PstI (expect 2149bp and 2642bp - gel purify larger band)Not shown<br />
<br />
[[Image:UVP00161annot.jpg]]<br />
<br />
Cutout all four bands and gel purify.<br />
I725024 was digested and gel-purified seperately.<br />
Quantitation of bands showed ~5pmol/ul for BuOP2/SpeI+PstI digests and ~7pmol/ul for I725024/XbaI+PstI digests.<br />
<br />
Ligations (fast tracking construction). Plate 150ul on LB+Amp<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
JP?<br><br />
PCR thiolase<br><br />
Transformed Buddy in Boo 1+2 into competentent cells, plated on AMP+ plates<br />
<br />
WM - Do Colony PCR on 7 colonies (from very few transformants) with Primer 4 and VR (expect ~240bp if good).<br />
<br />
[[Image:UVP00165annot.jpg]]<br />
<br />
Didn't work very well. Try confirming by digest.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
MC, JG @ 800hrs<br><br />
Ran gel of PCR products<br><br />
No growth on the buddy in Boo transformation<br><br />
Religations of buddy into boo but couldnt find Buddy therefore religations halted<br />
<br />
WM - Verify BuOP3 by digest with XbaI+SpeI (expect 2.1 and 5.6kb bands if good)<br />
<br />
[[Image:UVP00166annot.jpg]]<br />
<br />
Sequence 1, 4, 5, 6 with Primer 3 to confirm<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
ML<br><br />
Religated buddy and Boo<br><br />
Note: when free of tasks work on poster, or presentation or wiki or call justin or erin<br />
<br />
WM - BuOP3.4 and 3.5 sequenced good. Due to time considerations we will call BuOP3.4 part I725099 and submit this.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
JG, MC<br><br />
Retransform Buddy and Boo34<br><br />
Transform tholase<br><br><br />
<br />
JP<br><br />
Restriction of thiolase with ECO/PST<br><br />
Ran gel<br><br />
Transform rom Bud "2" oct 12<br><br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
Re-digestions for re-ligations of boo34 and buddy<br><br />
Digest boo34 s/p<br><br />
Ran gel<br><br />
Extract tholase from oct 14 into tube labelled "THiolase band EX"<br><br />
Updated wiki<br><br><br />
<br />
To do:<br><br />
Extract gel<br><br />
Ligate with buddy<br><br />
Run ligation on gel<br><br />
Extract<br><br />
Transform<br><br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
NK- Digested B0034 with Spe and PST.<br />
-Ran a gel of restriction<br />
-Extracted Thiolase from gel on previous day.<br />
<br />
VH and AL - Took a picture of gel<br />
-Cut out and purified four bands of B0034 from previous digestion<br />
<br />
JP- Ligate B0034 with Buddy<br />
<br />
WM - Verifying I725025 a.k.a. Buddy in Boo)<br />
The ligation and transformation already seem to have been done and produced many colonies. So I will do colony PCR with Primer 5 and VR (expect 250 bp) to confirm.<br />
<br />
[[Image:UVP00169annot.jpg]]<br />
<br />
All 16 colonies tested look good. Setup 12 O/Ns to verify by digest.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
WM verify I725025 by /XbaI+SpeI digest (expect 2149+1.2kb bands)<br />
<br />
[[Image:UVP00170annot.jpg]]<br />
<br />
All looked good. Sequence 1, 2, 9, 10.<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
WM - I725025 sequences all good. Use #1. <br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
I'll be there at 3-NK<br />
<br />
WM - Add arabinose promoter in front of individual genes so that each protein can be seperately expressed and purified using the His-tags we introduced.<br />
<br />
Arabinose promoter (+AraC repressor) comes frmo I0500.<br />
<br />
Digests: <br />
I725021/EcoRI+XbaI<br />
I725022/EcoRI+XbaI<br />
I725023/EcoRI+XbaI<br />
I725024/EcoRI+XbaI<br />
I725025/EcoRI+XbaI<br />
I0500/EcoRI+SpeI<br />
<br />
[[Image:UVP00173annot.jpg]]<br />
<br />
Note: I0500 concentration is quite low. Probably need to grow it up O/N then induce O/N with IPTG after that.<br />
<br />
Setup ligations anyway.<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
WM - very few colonies from ligation<br />
Did 1 O/N from each kind of ligation/transformation for digest verification.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
WM - Digest O/Ns of arabinose + individual genes for I725021, 022, 024, 025<br />
Digest with /XbaI+SpeI<br />
<br />
Expected sizes (in addition to common 2149bp band):<br />
I725021 - 2100bp<br />
I725022 - 2400bp<br />
I725024 - 3839bp<br />
I725025 - 2435bp<br />
<br />
[[Image:UVP00175annot.jpg]]<br />
<br />
First and last ligation looked like they worked. We will try to do this again.<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:33:17Z<p>Vhouston: /* September 27 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Started overdays of I0500 picked colonies. (Left in shaker at 37 deg)<br />
<br />
Did a mini prep on I0500, followed protocols in Fermentas Kit<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digest I0500 with ECO and SPE - only half completed because ran out of SPE.<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
ML<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Completed digests from yesterday that could not be finished due to a lack of SPE.<br />
<br />
Ran a gel of products of digest but did not yield a good picture and gel was discarded.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Redid overnights of I0500 so that they can be Re-minid.<br />
<br />
Ran a new gel of the previous minid I0500s to see what is wrong with them. Result shows that there is not enough DNA for these samples to be usefull.<br />
<br />
Started PCR for Thiolase.<br />
<br />
Made overnights of Buddy in B0034 using the glycerol stocks.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:29:19Z<p>Vhouston: /* September 26 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Started overdays of I0500 picked colonies. (Left in shaker at 37 deg)<br />
<br />
Did a mini prep on I0500, followed protocols in Fermentas Kit<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digest I0500 with ECO and SPE - only half completed because ran out of SPE.<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
ML<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Completed digests from yesterday that could not be finished due to a lack of SPE.<br />
<br />
Ran a gel of products of digest but did not yield a good picture and gel was discarded.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:27:21Z<p>Vhouston: /* September 25 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Started overdays of I0500 picked colonies. (Left in shaker at 37 deg)<br />
<br />
Did a mini prep on I0500, followed protocols in Fermentas Kit<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digest I0500 with ECO and SPE - only half completed because ran out of SPE.<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:26:01Z<p>Vhouston: /* September 24 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Started overdays of I0500 picked colonies. (Left in shaker at 37 deg)<br />
<br />
Did a mini prep on I0500, followed protocols in Fermentas Kit<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:22:59Z<p>Vhouston: /* September 24 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Started overdays of I0500 picked colonies. (Left in shaker at 37 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:21:23Z<p>Vhouston: /* September 23 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Repeat digestion of I0500 with 16 microlitres this time.<br />
<br />
Ran on a gel, but did not provide a good picture and discarded.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:18:38Z<p>Vhouston: /* September 22 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Digested J61003 with ECO and XBA.<br />
<br />
Digested I0500 with ECO and SPE.<br />
<br />
Made a gel and ran the restrictions described above.<br />
<br />
Gel Extracted J61003 band from the gel. (Stored in -20 deg)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:15:29Z<p>Vhouston: /* September 21 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Restricted I0500 with ECO and XBA.<br />
<br />
Ran a gel of digested I0500.<br />
<br />
Took a picture of gel for analysis in the following lab day.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:14:02Z<p>Vhouston: /* September 20 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked single colonies from growth on I0500 plates and made overnights and replated on kan plates.<br />
<br />
Restrictions on DBBEBB and DBBBE are restarted, XPA and PST, SPE and PST.<br />
<br />
Sequencing reactions of Buddy, Betty, Benny, Enny and DB.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:10:01Z<p>Vhouston: /* September 19 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
<br />
Picked up I0500 from Mike and plated on KAN plates.<br />
<br />
Made a gel with EtBr in the gel.<br />
<br />
Ran a gel of the digests that occurred on September 18th.<br />
<br />
Took picture of gel for analysis tomorrow.<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:09:29Z<p>Vhouston: /* September 19 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<b>Lab Notes:</b><br><br />
Picked up I0500 from Mike and plated on KAN plates.<br />
Made a gel with EtBr in the gel.<br />
Ran a gel of the digests that occurred on September 18th.<br />
Took picture of gel for analysis tomorrow.<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:06:14Z<p>Vhouston: /* September 18 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
<b>Lab Notes:</b><br><br />
Mini preped DBEBB and DBBBE, 4 overnights each.<br />
Made glycerol stocks of overnights (in -80 deg)<br />
<br />
NK-6PM<br />
<br />
<b>Lab Notes:</b><br><br />
Restrict DBEBB and DBBBE with XBA and PST, and SPE and PST. <br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-10-24T23:01:05Z<p>Vhouston: /* September 6 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<br />
<b>Lab Notes:</b><br><br />
Transformed BB Boo DB and BE Boo DB and plated onto Amp plates. (In 37 deg)<br />
<br />
Started overnights of R0080 from picked colonies, used Amp. (In shaker)<br />
<br />
Restreaked I0500 for single colonies on plates. (Left at 37 deg)<br />
<br />
<br />
<br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
NK-6PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
930-1230 NK<br />
<br />
1-ish - AL<br />
<br />
2pm-ish - VH<br />
<br />
TO DO LIST:<br />
<br />
1)<br />
<br />
looking through the book to last thursday at my sequencing reactions and figure out exactly what samples I used for X-2, X-3, and X-4?<br />
<br />
2)<br />
<br />
If there is not much left (less than 20 microL), can you transform into bacteria so we can complete another mini? (only 1 transformation for each)<br />
<br />
3) <br />
<br />
place each of those tubes in a rack or something and leave directions so wayne can find it.<br />
<br />
4)<br />
<br />
X-1 has two prefixes, so its garbage, but X-5 might be ok. I couldn't find a terminator or a suffix. So... Can you complete a restriction on X-5 with Eco/Spe and Eco/Pst and run on a gel to make sure it cuts properly (and therefore those restriction sites exist)<br />
<br />
5)<br />
<br />
run sequencing reaction on more X-1 and X-5's (look at the chart erin made from back in the day - its a fold out piece of paper in the master book)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
1-ish - AL<br />
<br />
CZ 2:30pm<br><br />
Redid miniprep of I0500 induced by IPTG(1C,1D,2C)and elute in 40 microlitre<br><br />
Ran 3microliter ona gel but nothing appeared<br><br />
Miniprep discarded because of lack of DNA<br><br />
James took 1D culture ands ub culture and perhaps induce with IPTH again.<br><br />
Restarted 1C and 2C (5ml LB, 5microlitre K, 100microlitre culture)<br><br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
ED 9:00 am<br><br />
Made of gel of James's Miniprep digests<br><br />
Digest I0500 with ECORI and SPE<br><br />
Transformations of Ligations Enny + J61003 and Betty + J61003<br><br />
<br />
NK 1130-230<br><br />
Loaded gel but samples were incorrectly loaded<br><br><br />
CZ 2:00 pm<br><br />
Loaded gel of Erin's digests<br><br />
Gel extraction<br><br />
Ligation with J61003 E, X<br><br />
<br />
Note:The new TAE is taking much longer to solidify when 1%. <br><br />
<br />
JP evening<br><br />
Tholase PCR<br><br />
Sequencing reactions of DB in Boo and Buddy in Boo<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
ED 9:00 Am<br><br />
Transformed Buddy+J61003, I0500+J61003 #1 and #2<br><br />
Plated all cells on AMP<br><br />
O/Ns of Enny+J61003 and Benny+J61003<br><br />
NG 12:00 am<br><br />
<br />
JP<br><br />
Tholase blunt end topo reaction<br><br />
Completed reaction and tholase mix is in orange PCR tube rack at -20<br><br />
<br />
Note:<br><br />
1) We need XGAL!!<br><br />
2) Colonies that are blue do not have thiolase in them, colonies that are wight do have thiolase in them.<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-23T22:51:07Z<p>Vhouston: /* '''Project Timeline''' */</p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns in the global energy market there has been a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. In addition, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuels source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, cold starting, or volatile organic pollution standards. Blending butanol with gasoline also prevents modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns.<br />
<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''E.coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production in ''Clostridium acetobutylicum'' into ''E.coli''. Furthermore, we hope to increase the E.coli's tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are looking into the use of a photoautotrophic bacterium, ''Chlorobium tepidum'', that we will also introduce butanol producing genes into. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees celcius (104 degrees fahrenheit for the yankees), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
Insert GANTT Chart here<br />
<br />
== '''Become A Partner''' ==<br />
<br />
This summer, eleven members are participating in this very exciting project voluntarily without monetary stipend and fundraising to do the project from scratch. We would love to form a relationship with your organization's support to help achieve our goals in this exciting learning experience. <br><br />
<br />
If your organization is interested in becoming a partner and supporting our exciting learning adventures, contact our fundraising coordinator Michelle; mcchan[at]ualberta.ca or our mentor Dr. Michael Deyholos; deyholos[at]ualberta.ca<br><br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_uofa.gif]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_ingenuity.gif]]<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_UofABS.gif]]<br />
|-<br />
|}<br />
<br />
<br />
'''Monetary''' (in alphabetical order)<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_Arc_color.GIF]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Awsn.jpg]]<br />
| width="100pt"<br />
| width="200pt" | [[Image: Alberta_Bio_alberta.jpg]]<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Gem.jpg]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Trimliner.jpg]] <br />
<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Biochemr.jpg]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Office_of_provostr.jpg]] <br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Pmcol.jpg]] <br />
| width="100pt" | <br />
| width="100pt" | [[Image:Alberta_Sciencer1.jpg]] <br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Student_unionr.jpg]]<br />
|-<br />
|}<br />
<br />
<br />
'''Supplies''' (in alphabetical order)<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_AB.gif]] <br />
| width="50pt" | <br />
| width="100pt" | [[Image:Alberta_Nebr.jpg]]<br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_Qiagenr.jpg]]<br />
|-<br />
|} <br />
<br />
<br />
'''In-Kind'''<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_biobasic.gif]] <br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_geneart.gif]]<br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_Office_of_dean_of_studentsr.jpg]]<br />
|-<br />
|} <br />
<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor,''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta,''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta,''<br><br />
'''Dr. David Bressler''' - ''University of Alberta,''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta,''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta,''<br><br />
'''Dr. Donald Bryant''' - ''Penn State,''<br><br />
'''Dr. Gaozhong Shen''' - ''Penn State,''<br><br />
'''Amaya Garcia''' - ''Penn State,''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta,''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta,''<br><br />
'''Dr. Federick West'''-''University of Alberta,''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta,''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
<br />
<br />
<br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
[[Alberta/Calender/November|November 2007]]<br />
<br />
== '''Discussion Board''' ==<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
== '''Protocols''' ==<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
== '''Files''' ==<br />
<br />
Meeting minutes, agendas and action items can be found '''[[alberta/meeting files|here]]'''<br />
<br />
Other shared files can be found '''[[alberta/files|here]]'''. (If you have a file to post please contact Nick Glass)<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
<br />
== '''Edmonton''' ==<br />
<br />
For more on the city of Edmonton click [http://www.ualberta.ca/~mjl3/About.html here].<br />
<br />
For more info on the University of Alberta '''[http://www.ualberta.ca University of Alberta click here]'''<br />
<br />
== '''External Links''' ==<br />
<br />
'''Computational Modelling'''<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/AlbertaAlberta2007-10-23T22:42:47Z<p>Vhouston: </p>
<hr />
<div><center>[[Image: headbanner.jpg]] <br />
<br><br />
''The Offical Wiki of the 2007 University of Alberta iGEM Team'' <br><br />
''Edmonton, Alberta, Canada </center>''<br />
<br />
== '''Background: Biofuels'''==<br />
<br />
<br />
With growing concerns in the global energy market there has been a continual push for the development of renewable energy sources. Specifically, two fuels have dominated the media: biodiesel and ethanol. However, both of these fuels have shortcomings in terms of being a viable fuel source.<br />
<br />
<br />
Biodiesel is a fuel produced from the vegetable oils of crops that can be used in an engine system very similar to a traditional diesel engine. However, vegetable oils in crops only make up a small portion of the biomass of the plants, ultimately producing low yields of fuel per acre of crops. As such, it is more economically sound to use these resources for food production.<br />
<br />
<br />
There has been huge attention to the use of ethanol in the typical auto cycle engine. In many places it is already being blended with gasoline to create a hybrid fuel source. However, running an engine on pure ethanol is beset by several major obstacles. Firstly, ethanol is miscible with water at any concentration, which creates long term storage corrosion issues. In addition, ethanol engines must be designed to expect water vapor unlike their gasoline counterparts. Ethanol also has significantly different thermodynamic properties than gasoline such as a lower energy density and different vapor properties, which would reduce the economical advantage of using ethanol as a primary fuels source.<br />
<br />
<br />
We propose using a different fuels source to eventually replace gasoline, butanol. Butanol is a superior to ethanol as a replacement for petroleum gasoline. With a low vapor pressure, high energy density, and a gasoline-like octane rating, it can be blended into existing gasoline at much higher proportions than ethanol without compromising performance, mileage, cold starting, or volatile organic pollution standards. Blending butanol with gasoline also prevents modifications of the fuel-air ratio and modifications to the fuel system. Butanol also is immiscible with water at concentrations higher than 7%, alleviating storage concerns.<br />
<br />
<br />
More information on the summary of biofuels viability and the inspiration to our project can be found '''[[Alberta/background|here]]'''.<br />
<br />
== '''The Project: Plan B''' ==<br />
<br />
We propose the use of butanol as the leading biofuel for use in internal combustion engines. Specifically, we intend to genetically engineer ''E.coli'' bacteria to convert biomasses into butanol for use as an energy source. This will be accomplished by introducing the genes responsible for butanol production in ''Clostridium acetobutylicum'' into ''E.coli''. Furthermore, we hope to increase the E.coli's tolerance to solvents such as butanol.<br />
<br />
<br />
Concurrently, we are looking into the use of a photoautotrophic bacterium, ''Chlorobium tepidum'', that we will also introduce butanol producing genes into. ''Chlorobium tepidum'' is a green sulfur bacterium that is strictly anaerobic and uses sulfur compounds as terminal electron donors. ''Chlorobium tepidum'' is a moderately thermophillic bacterium, growing at 40 degrees celcius (104 degrees fahrenheit for the yankees), and requires low light conditions for optimal growth. These bacteria grow well in a defined medium, utilizing the reverse/reductive tricarboxylic acid (TCA) cycle to build up carbohydrates from carbon dioxide. For a more comprehensive overview of ''Chlorobium tepidum'' go to http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
[[Image:spacer.jpeg|left]][[Image:Alberta_micrograph.gif|thumb|300px|left|Figure 1:''Chlorobium tepidum'' Transmission Micrograph Image]]<br />
[[Image:Alberta_gramstain.jpg|thumb|330px|left|Figure 2:''Chlorobium tepidum'' Standard Light Microscope Image]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br />
Figure 1 and 2 Images from http://www.bmb.psu.edu/faculty/bryant/lab/chlorobiumtepidum/index.html<br />
<br />
The advantage of manipulating this organism for butanol production is a matter of energy input. Rather than having to utilize vast amounts of food stocks, such as grains or sugars, a photoautotroph will fix carbon dioxide into the complex carbohydrates required for butanol production. Theoretically, if the only fuel on our planet was butanol, and it was produced in this manner, there would be little net carbon dioxide produced.<br />
<br />
== '''Project Timeline''' ==<br />
<br />
<center>[[Image: Alberta_timeline.jpg]] </center><br />
<br><br />
<br />
<br />
<br />
== '''Become A Partner''' ==<br />
<br />
This summer, eleven members are participating in this very exciting project voluntarily without monetary stipend and fundraising to do the project from scratch. We would love to form a relationship with your organization's support to help achieve our goals in this exciting learning experience. <br><br />
<br />
If your organization is interested in becoming a partner and supporting our exciting learning adventures, contact our fundraising coordinator Michelle; mcchan[at]ualberta.ca or our mentor Dr. Michael Deyholos; deyholos[at]ualberta.ca<br><br />
<br />
<br />
<b>Major Sponsors</b><br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_uofa.gif]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_ingenuity.gif]]<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_UofABS.gif]]<br />
|-<br />
|}<br />
<br />
<br />
'''Monetary''' (in alphabetical order)<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_Arc_color.GIF]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Awsn.jpg]]<br />
| width="100pt"<br />
| width="200pt" | [[Image: Alberta_Bio_alberta.jpg]]<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Gem.jpg]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Trimliner.jpg]] <br />
<br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Biochemr.jpg]]<br />
| width="100pt" | <br />
| width="100pt" | [[Image: Alberta_Office_of_provostr.jpg]] <br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Pmcol.jpg]] <br />
| width="100pt" | <br />
| width="100pt" | [[Image:Alberta_Sciencer1.jpg]] <br />
|-<br />
|}<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="100pt" | [[Image: Alberta_Student_unionr.jpg]]<br />
|-<br />
|}<br />
<br />
<br />
'''Supplies''' (in alphabetical order)<br />
<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_AB.gif]] <br />
| width="50pt" | <br />
| width="100pt" | [[Image:Alberta_Nebr.jpg]]<br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_Qiagenr.jpg]]<br />
|-<br />
|} <br />
<br />
<br />
'''In-Kind'''<br />
<br />
{| align="center" style="color:white;"<br />
|- <br />
| width="200pt" | [[Image: Alberta_biobasic.gif]] <br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_geneart.gif]]<br />
| width="50pt" | <br />
| width="100pt" | [[Image: Alberta_Office_of_dean_of_studentsr.jpg]]<br />
|-<br />
|} <br />
<br />
<br />
'''Advice'''<br />
<br />
<br />
'''Andrew Hessel''' - ''Alberta Ingenuity Mentor,''<br><br />
'''Dr. Jonathan Dennis''' - ''University of Alberta,''<br><br />
'''Dr. Perrin Beatty''' - ''University of Alberta,''<br><br />
'''Dr. David Bressler''' - ''University of Alberta,''<br><br />
'''Dr. Charles Lucy''' - ''University of Alberta,''<br><br />
'''Dr. Gregory Kiema''' - ''University of Alberta,''<br><br />
'''Dr. Donald Bryant''' - ''Penn State,''<br><br />
'''Dr. Gaozhong Shen''' - ''Penn State,''<br><br />
'''Amaya Garcia''' - ''Penn State,''<br><br />
'''Dr. Mark S. Peppler''' - ''University of Alberta,''<br><br />
'''Dr. James Harynuk''' - ''University of Alberta,''<br><br />
'''Dr. Federick West'''-''University of Alberta,''<br><br />
'''Dr. Todd Lowary'''-''University of Alberta,''<br><br />
'''Desiree Schell''' - ''University of Alberta CJSR''<br><br />
'''Dr. Jeff Fuller''' - ''University of Alberta/Capital Health''<br><br />
'''Dr. Julia Foght''' - ''University of Alberta''<br><br />
<br />
<br />
<br />
<br />
<br />
A list of experimental supplies we need can be found '''[[supplies|here]]'''<br />
<br />
== '''Lab Book and Calendar''' ==<br />
[[image: Alberta_butapipettips.jpg]][[image: Alberta_arrow.jpg]] [[image: Alberta_Labbook.jpg]] <br><br />
<br />
Butanerd Event Calendar can be found below:<br />
<br />
[[Alberta/Calender/July|July 2007]]<br />
<br />
[[Alberta/Calender/August|August 2007]]<br />
<br />
[[Alberta/Calender/September|September 2007]]<br />
<br />
[[Alberta/Calender/October|October 2007]]<br />
<br />
[[Alberta/Calender/November|November 2007]]<br />
<br />
== '''Discussion Board''' ==<br />
<br />
'''[http://butanerds.myfreeforum.org The Butanerd Online Forum]''' is up and running. Feel free to post and check for posts here. Make sure you register!<br />
<br />
== '''Protocols''' ==<br />
<br />
[http://www.ualberta.ca/~mjl3/UofAIgemProtocols.pdf The Lab Protocols]<br />
<br />
== '''Files''' ==<br />
<br />
Meeting minutes, agendas and action items can be found '''[[alberta/meeting files|here]]'''<br />
<br />
Other shared files can be found '''[[alberta/files|here]]'''. (If you have a file to post please contact Nick Glass)<br />
<br />
== '''The Team''' ==<br />
<br />
<center>[[Image: Alberta_team.jpg]] </center><br />
<br><br />
<br />
Our team has a rich background in biology, biochemistry and engineering. To compliment our diversity we also have advisors who have a wealth of knowledge in research and applications of genetic engineering. For more information about the group, check out the '''[[Alberta/Members|University of Alberta's iGEM Team Members Page]]'''.<br />
<br />
Our University of Alberta Student Group Constitution can be found '''[[alberta/constitution|here]]'''<br />
<br />
<br />
== '''Edmonton''' ==<br />
<br />
For more on the city of Edmonton click [http://www.ualberta.ca/~mjl3/About.html here].<br />
<br />
For more info on the University of Alberta '''[http://www.ualberta.ca University of Alberta click here]'''<br />
<br />
== '''External Links''' ==<br />
<br />
'''Computational Modelling'''<br />
<br />
[http://www.systems-biology.org/cd Cell Designer Homepage]<br />
<br />
[http://www.biomodels.org Biomodels Home Page]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-02T18:26:57Z<p>Vhouston: /* October 2 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
VH-1PM<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
CZ - 7:00pm<br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
NK - 930<br><br />
VH - 2pm<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
MC - 800hrs <br><br />
CZ - 2:30pm<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br><br />
NK 2pm<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/OctoberAlberta/Calender/October2007-10-01T19:54:38Z<p>Vhouston: /* October 4 */</p>
<hr />
<div><div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/October|October 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<br />
<tr><br />
<td></td><br />
<td>[[Alberta/Calender/October#October_1|1]]</td><br />
<td>[[Alberta/Calender/October#October_2|2]]</td><br />
<td>[[Alberta/Calender/October#October_3|3]]</td><br />
<td>[[Alberta/Calender/October#October_4|4]]</td><br />
<td>[[Alberta/Calender/October#October_5|5]]</td><br />
<td>[[Alberta/Calender/October#October_6|6]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_7|7]]</td><br />
<td>[[Alberta/Calender/October#October_8|8]]</td><br />
<td>[[Alberta/Calender/October#October_9|9]]</td><br />
<td>[[Alberta/Calender/October#October_10|10]]</td><br />
<td>[[Alberta/Calender/October#October_11|11]]</td><br />
<td>[[Alberta/Calender/October#October_12|12]]</td><br />
<td>[[Alberta/Calender/October#October_13|13]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_14|14]]</td><br />
<td>[[Alberta/Calender/October#October_15|15]]</td><br />
<td>[[Alberta/Calender/October#October_16|16]]</td><br />
<td>[[Alberta/Calender/October#October_17|17]]</td><br />
<td>[[Alberta/Calender/October#October_18|18]]</td><br />
<td>[[Alberta/Calender/October#October_19|19]]</td><br />
<td>[[Alberta/Calender/October#October_20|20]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_21|21]]</td><br />
<td>[[Alberta/Calender/October#October_22|22]]</td><br />
<td>[[Alberta/Calender/October#October_23|23]]</td><br />
<td>[[Alberta/Calender/October#October_24|24]]</td><br />
<td>[[Alberta/Calender/October#October_25|25]]</td><br />
<td>[[Alberta/Calender/October#October_26|26]]</td><br />
<td>[[Alberta/Calender/October#October_27|27]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/October#October_28|28]]</td><br />
<td>[[Alberta/Calender/October#October_29|29]]</td><br />
<td>[[Alberta/Calender/October#October_30|30]]</td><br />
<td>[[Alberta/Calender/October#October_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/September|September 2007]]<br><br />
To [[Alberta/Calender/November|November 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== October 1 == <br><br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 3 == <br><br />
<br />
MC - 800hrs <br><br />
CZ - 7:00pm<br><br />
<br />
<b>NB: please note the lab is unavailable EVERY wednesday from 1400-1700hrs</b><br><br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 4 ==<br />
<br />
VH - 2pm<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 5 ==<br />
<br />
MC - 800hrs <br><br />
CZ - 2:30pm<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 6 ==<br />
<br />
ED 9:00<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 7 ==<br />
<br />
ED 9:00<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 8 ==<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 9 ==<br />
<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 10 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 11 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 12 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 13 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 14 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 15 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 16 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 17 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 18 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
== October 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/October#October|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/September|To September 2007]]<br><br />
[[Alberta/Calender/Novemeber|To November 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-24T20:00:59Z<p>Vhouston: /* September 27 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
NK-6PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
930-1230 NK<br />
<br />
2pm-ish - VH<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
VH - 2pm-ish<br />
<br />
JP- evening<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
CZ 2:30pm<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
CZ 2:00 pm<br />
<br />
JP evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-24T20:00:20Z<p>Vhouston: /* September 25 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br><br />
Miniprep I0500<br><br />
DB BE and DB-BB transformations did not work.<br><br />
Re-ligated DB into BB boo and DB into BE boo<br><br />
<br />
<br />
11-2:<br />
AL,ML<br><br />
Re-transform BE+DB and BB+DB<br><br />
<br />
2-5:<br />
VH<br><br />
Gel extraction of I0500, but we missed the step "restricting with Ecori+speI" <br><br />
<br />
5-8:<br />
JP,NK<br><br />
Restrction on I0500 mini's with Ecori and SPeI<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br><br />
Double digest of BB-DB/BE-DB XBA/PST<br><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br><br />
Ran gel of the restrictions made in MID, Sept 10 by ML and AL.<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
Restrictions of BB+DB with XBA/PST and BE+DB with PST, SPE<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br><br />
Ran gel on restrictions made by NK in AM of Sept 11<br />
<br />
Night- ED JP<br><br />
Gel extractions<br><br />
Ligations of DB+BB + BE and DB+BE + BB<br><br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH <br><br />
lab class 2-5<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Transformed BEDBB and BBDB into XL 10 gold<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Digested BEBOO and BBBOO with PST and XBA<br />
<br />
PM - VH, JG<br><br />
Ran gel of restrictions made in the previous shift.<br><br />
<br />
Meeting 7:00<br />
<br />
After lab shift, JG, JP<br><br />
Overnights with AMP of BBDB + BEDB<br><br />
Gel extractions from gel made in the prevous shift<br><br />
bands 1,2 (BE) correct while band 3 is too large to be BB<br><br />
Sequence reactions can now be started using primers 1-5 that have been diluted to 5pmol/microlitre in H20 not TE<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL, JG<br><br />
Restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
PM - VH, CZ<br><br />
Ran gel on restrictions on BBDBE and BEDBB with xba/pst and spe/pst<br><br />
Gel extracions<br><br />
<br />
night - JP<br><br />
Sequencing reactions<br><br />
BBDBBE 6 reactions<br><br />
BEDBBB 6 reactions<br><br />
BB 3 reactions<br><br />
BE 3 reactions<br><br><br />
General note: Each primer sequence will be the end of the indicated gene to show us wether the joining/ligations worked correctly (VF is the promoter/gene/juction)<br><br />
To do: Submit to MBSU<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br><br />
General Note:We have cloned all 5 genes in series, in to differnt orders. Waiting for I0500 which couls be completed on monday. To make sure we have cloned correctly will also need to wait for the squencing results. This weekdn we will clone the 5 gense in 2 differnt orders. The digest have already been done<br><br />
Gel extraction of gel bands of XBA,PST of BBDBBE and BEDBBB. THese can be used to cone into I0500 J61003<br><br />
Ligations of DBBB into BE and DBBE into DBBEBB<br><br />
Leave at 20 degrees celsius for 10 hours<br><br />
5-8 - NK<br />
Cant find the competent cells. <br><br />
Competent cells are in -80 freezer 2nd shelf from the bottom-ML, NG<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br><br />
Transform ligations of DBBEBB and DBBBBE into competent cells. <br><br />
Plated on AMP with whole ligations<br><br />
General Info: When DBBEBB and DBBBBE are complete run sequence reaction<br><br />
Follow "flouresence sequence reaction" protocol<br><br />
<br />
11-2 VH, CZ<br><br />
<br />
2-5 MC, JP<br><br />
<br />
5-8 - ML, NG<br><br />
No growth on DBBBBE or DBBBBE at 1700<br><br />
Retransformed into competent cells DBBEBB and DBBBBE<br><br />
Plated 2 of each and lover overnight at 37 degrees<br><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs)<br><br />
- delivered MSBU sequencing samples<br><br />
- O/days of Ligations from yesterday<br><br />
<br />
<b>NB: AMP plates are marked with a red streak down the SIDE of the plate. if it does not have this - then it is NOT AMP</b><br><br />
<br />
ML (~10:30-1:00)<br><br />
<br />
<b>To do:</b><br><br />
miniprep of DBBEBB and DBBBBE & glycerol stocks<br><br />
restrict with (1)XBA/PST, (2)SPE/PST<br><br />
Ruun gel of UNCut DBBEBB and DBBBBE, Cut with XBA/PST and CUT with SPE/PST<br><br />
GEl extract XBA/PST bands<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br><br />
Sorry guys, I havent done mini-preps before so just incase I mess up i decided not do it. Instead I made a gel for tonight and update the wiki (even the missing parts from before).<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
NK-6PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<b>if you're the first one in; I0500 arrived - pop by and give Mike a visit!:) </b><br />
<br />
MC - in the AM - unsure what time because has to be downtown for a class project @900hrs (hoping to get out of there within a hour) so maybe 10/1030? <br />
<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~1:00 - 2:00<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
YES - MC <br />
<br />
VH, see notes on Sept 12. - AL<br />
<br />
ED- 6PM <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 930 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG, MC- (@5PM)<br />
<br />
JP- late<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
JP evening<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
Poster Meeting @ 11:00am<br />
Meet in sub By the Subway--JG<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
AM -JG @ 8000hrs <br><br />
MC @ 845 - going to stop by dean of students' to pick up swag first.<br />
<br />
<br />
PM - NK @5 <br><br />
sorry, cant make it till 630<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
930-1230 NK<br />
<br />
2pm-ish - VH<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
NK 930-1230 <br><br />
<br />
JP- evening<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
JG & MC - 8:00AM <br><br />
<br />
CZ 2:30pm<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
CZ 2:00 pm<br />
<br />
JP evening<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-17T15:36:02Z<p>Vhouston: /* September 19 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br />
<br />
11-2:<br />
AL,ML<br />
<br />
2-5:<br />
VH,NK<br />
<br />
5-8:<br />
JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br />
<br />
Night- ED JP<br />
<br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH (I will be in at about 1 or 1:30PM, if there is something written down for me to do I can work at it by myself, otherwise if someone wants to come in and get me started on something that would be nice.)<br />
<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Sorry I have meeting at 6pm which should last no longer than 2 hours, so I will come at 8pm the latest.<br><br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Hey guys, i wont be able to make it till 930 AM-NK<br />
<br />
PM - VH, JG<br />
<br />
Meeting 7:00<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL<br />
<br />
PM - VH, CZ<br />
<br />
night - JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br />
<br />
11-2 - JG, ML<br />
<br />
2-5 - NG, CZ<br />
<br />
5-8 - NK, I have it covered.<br />
<br />
Could not do transformation ligations because could not find competent cells. The ligations are in the -20 freezer with the green tape saying "ligations, sept 15". -NK<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br />
<br />
11-2 VH, CZ<br />
<br />
2-5 MC, JP<br />
<br />
5-8 - ML, NG<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - JG (800 hrs - 930hrs),MC (@ 800hrs), ML (~10:30-1:00)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
NK - 8 AM<br />
<br />
VH - (@1pm)<br />
<br />
AL - 12-2pm<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
ML - ~10:30 - 1:00<br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM<br />
<br />
Last Wednesday there was a lab class in our lab from 2-5, is this going to be a regular occurence? -VH<br />
<br />
ED- 6PM <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
NK - 8 AM<br />
<br />
VH - (@1PM)<br />
<br />
JG- (@5PM)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC, JG (@ 800hrs), <br />
<br />
ML (~10:30 - 1:00)<br><br />
<br />
AL - ~12:30 - 2:00<br />
<br />
CZ-2:15PM <br> <br />
ED - 4 PM<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
ED 9-12<br />
<br />
NG 12-3<br />
<br />
NK 230-530<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-16T16:57:45Z<p>Vhouston: /* September 20 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br />
<br />
11-2:<br />
AL,ML<br />
<br />
2-5:<br />
VH,NK<br />
<br />
5-8:<br />
JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br />
<br />
Night- ED JP<br />
<br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH (I will be in at about 1 or 1:30PM, if there is something written down for me to do I can work at it by myself, otherwise if someone wants to come in and get me started on something that would be nice.)<br />
<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Sorry I have meeting at 6pm which should last no longer than 2 hours, so I will come at 8pm the latest.<br><br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Hey guys, i wont be able to make it till 930 AM-NK<br />
<br />
PM - VH, JG<br />
<br />
Meeting 7:00<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL<br />
<br />
PM - VH, CZ<br />
<br />
night - JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br />
<br />
11-2 - JG, ML<br />
<br />
2-5 - NG, CZ<br />
<br />
5-8 - NK, I have it covered.<br />
<br />
Could not do transformation ligations because could not find competent cells. The ligations are in the -20 freezer with the green tape saying "ligations, sept 15". -NK<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br />
<br />
11-2 VH, CZ<br />
<br />
2-5 MC, JP<br />
<br />
5-8 - ML, NG<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - MC (@ 800hrs)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
<br />
VH - (@1pm)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
<br />
VH - (@1PM)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC (@ 800hrs) <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-16T16:56:57Z<p>Vhouston: /* September 18 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br />
<br />
11-2:<br />
AL,ML<br />
<br />
2-5:<br />
VH,NK<br />
<br />
5-8:<br />
JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
<br />
Mid - AL (12:30 - 2 ish), NG (random)<br />
<br />
Night- ED JP<br />
<br />
<b> mini relocation 1 bench back, do not use the first 3 benches of the lab or the blackboard from now on!</b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
<b> Important: Please evacuate lab before 2:00pm as there is a lab class starting at this time till 5pm! -AL</b><br />
<br />
PM - VH (I will be in at about 1 or 1:30PM, if there is something written down for me to do I can work at it by myself, otherwise if someone wants to come in and get me started on something that would be nice.)<br />
<br />
<b> VH: please make note of the above announcement regarding lab class at 2:00pm </b><br />
<br />
Night - CZ, ED<br><br />
Sorry I have meeting at 6pm which should last no longer than 2 hours, so I will come at 8pm the latest.<br><br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
Hey guys, i wont be able to make it till 930 AM-NK<br />
<br />
PM - VH, JG<br />
<br />
Meeting 7:00<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AM - MC (around 900/930hrs)<br><br />
- Mini prep from O/N of BBDBE & BEDBB<br><br />
- Glycerol stocks of BBDBE & BEDBB, and restreaked quartered plates<br><br />
- Gel extraction of BE & BB Xba/Pst<br><br />
- made gel<br> <br />
<br />
Mid - AL<br />
<br />
PM - VH, CZ<br />
<br />
night - JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br />
<br />
11-2 - JG, ML<br />
<br />
2-5 - NG, CZ<br />
<br />
5-8 - NK, I have it covered.<br />
<br />
Could not do transformation ligations because could not find competent cells. The ligations are in the -20 freezer with the green tape saying "ligations, sept 15". -NK<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br />
<br />
11-2 VH, CZ<br />
<br />
2-5 MC, JP<br />
<br />
5-8 - ML, NG<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
AM - MC (@ 800hrs)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
<br />
VH - (@1pm)<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
AM - MC (@ 800hrs) <br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-11T19:56:42Z<p>Vhouston: /* September 12 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br />
<br />
11-2:<br />
AL,ML<br />
<br />
2-5:<br />
VH,NK<br />
<br />
5-8:<br />
JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
<br />
Mid - AL (12:30 - 2 ish), NG (2:00-3:30/4)<br />
<br />
Night- ED JP<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
PM - VH (I will be in at about 1 or 1:30PM, if there is something written down for me to do I can work at it by myself, otherwise if someone wants to come in and get me started on something that would be nice.)<br />
<br />
Night - CZ, ED<br><br />
Sorry I have meeting at 6pm which should last no longer than 2 hours, so I will come at 8pm the latest.<br><br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
PM - VH, JG<br />
<br />
Meeting 7:00<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
<br />
Mid - AL<br />
<br />
PM - VH, CZ<br />
<br />
night - JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br />
<br />
11-2 - JG, ML<br />
<br />
2-5 - NG, CZ<br />
<br />
5-8 - NG, ( this is what i had copied down but if anyone else can take this im sure nick would be greatful)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br />
<br />
11-2 VH, CZ<br />
<br />
2-5 MC, JP<br />
<br />
5-8 - ML, NG<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/SeptemberAlberta/Calender/September2007-09-11T19:52:40Z<p>Vhouston: /* September 12 */</p>
<hr />
<div>=='''September'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/September|September 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td>[[Alberta/Calender/September#September_1|1]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_2|2]]</td><br />
<td>[[Alberta/Calender/September#September_3|3]]</td><br />
<td>[[Alberta/Calender/September#September_4|4]]</td><br />
<td>[[Alberta/Calender/September#September_5|5]]</td><br />
<td>[[Alberta/Calender/September#September_6|6]]</td><br />
<td>[[Alberta/Calender/September#September_7|7]]</td><br />
<td>[[Alberta/Calender/September#September_8|8]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_9|9]]</td><br />
<td>[[Alberta/Calender/September#September_10|10]]</td><br />
<td>[[Alberta/Calender/September#September_11|11]]</td><br />
<td>[[Alberta/Calender/September#September_12|12]]</td><br />
<td>[[Alberta/Calender/September#September_13|13]]</td><br />
<td>[[Alberta/Calender/September#September_14|14]]</td><br />
<td>[[Alberta/Calender/September#September_15|15]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_16|16]]</td><br />
<td>[[Alberta/Calender/September#September_17|17]]</td><br />
<td>[[Alberta/Calender/September#September_18|18]]</td><br />
<td>[[Alberta/Calender/September#September_19|19]]</td><br />
<td>[[Alberta/Calender/September#September_20|20]]</td><br />
<td>[[Alberta/Calender/September#September_21|21]]</td><br />
<td>[[Alberta/Calender/September#September_22|22]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_23|23]]</td><br />
<td>[[Alberta/Calender/September#September_24|24]]</td><br />
<td>[[Alberta/Calender/September#September_25|25]]</td><br />
<td>[[Alberta/Calender/September#September_26|26]]</td><br />
<td>[[Alberta/Calender/September#September_27|27]]</td><br />
<td>[[Alberta/Calender/September#September_28|28]]</td><br />
<td>[[Alberta/Calender/September#September_29|29]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/September#September_30|30]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
</tr><br />
<br />
<br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
To [[Alberta/Calender/October|October 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== September 1 ==<br />
<br><br />
<br />
<b> Lab Notes </b><br><br />
1. 24 Minipreps for Diezel Blaze in B0034 using Fermentas Kit; stored in -20 freezer<br><br />
2. Lots of colonies from the transformation last night; no colonies on negation control (good) and lots of colonies on positive control (good) and no satellite colonies (also good); no colonies were picked for overnights<br><br />
3. Run the Buddy+Benny in B00 and Betty+Enny in B00 Pst/Xba gel from last night at 50V for another 30 minutes for better resolution; all the digest worked so I cut out the appropriate bands and stored the gel in -20 freezer for purification later<br><br />
<br />
-CZ<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 3 ==<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 4 ==<br />
<b>Schedule:</b><br />
<br />
JP,ML,JG 7:00pm <br><br />
<br />
<br />
<u>For the record: </u><br><br />
Buddy = BuOH DH 1235 bp <br><br />
Betty = Bb-bhBu-coa dh 923 bp <br><br />
Benny = Butyryl coa dh 1184 bp <br><br />
enny = Enoyl coa Hydratase 860 bp <br><br />
Diezel Blaze = buAld-Dh 2639 bp<br><br />
<br />
<b> Notes:</b> <br><br />
Moving was done this mid-day. <br><br />
New location <b>M349</b> <br><br />
JG has key & access <br><br />
- MC, ED, JG <br><br />
<br />
Evening crew - please do a once over of G308 to double check we have not left anything and to clean up anything extra/ things we should get out of the way. thnx - MC <br><br />
<br />
<b>Night Crew</b><br />
<br />
-JP, JG<br />
<br />
Set up new lab <br />
<br />
Things we need <br />
- Water Bath, Scale, disposable 13ml overnight tubes, Tip waste<br />
<br />
<b> lab work </b><br />
<br />
Gel purification ran on Betty,enny and boo as well as buddy and benny and is in the -20 in the new lab<br />
<br />
To Do list for tomorrow<br />
<br />
- Restriction on DB needs to be done - If we want to put it in front of BE or BB then Spe/Pst - If we want to put it behind BE or BB then cut with Xba/Pst - maybe do both (use 4microL DNA for digest)<br><br />
<br />
-complete restriction on BE and BB for SPE and PST (then we can complete ligations BE-BB and BB-BE or we can ligate D.B into BE or BB to make BE-DB or DB-BE or BB-DB or DB-BB- Then we can ligate BE-BB-DB or DB-BE-BB or BE-BB-DB or BB-DB-BE or BB-BE-DB and we are kinda finished! <br><br />
<br />
- If I0500 comes in from calgary it needs to be transformed.<br />
<br />
- Transform R0080 which is a back up promoter just in case?<br />
<br />
<br />
<br />
-Note we also have to do sequenceing on BB and BE and DB<br />
<br />
Shout out to calgary for saving our necks <br />
Shout out to the move in crew <br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 5 ==<br />
<br />
<b>Schedule:</b><br />
<br />
NG,ED,ML 7:00pm <br><br />
<br />
<b>AM Crew Notes:</b><br><br />
<br />
finished up cleaning up post-move in<br> <br />
got a 'water bath' - JG calibrated it<br><br />
prepared BB in Boo & BE in Boo for sequencing - this will be ready for pick up tomorrow<br><br />
Restricted:<br><br />
- DB in BOO with PST/XBA<br><br />
- DB in BOO with PST/SPE<br><br />
- BB in BOO with PST/SPE<br><br />
- BE in BOO with PST/SPE<br><br />
<b>NB: there is a section in the masterbook "figuring stuff out" just a few questions I have from being away so long - don't worry about it we should do a wet lab recap to bring everyone on the same page at our meeting Thrusday - MC </b> <br><br />
<3 JG & MC <br><br />
<br />
Transformed I0500 from Calgary.<br />
Transformed R0080.<br />
Ran digestions on gel.<br />
Ligated digested DB with BB and BE. (all in Boo)<br />
<br />
-ED, ML<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 6 ==<br />
<b>Schedule:</b><br />
<br />
NK ED AL 5:00pm (Unless your crazy enough to show up at 5AM)<br><br />
<br />
<b>To Do:</b><br><br />
Ligations<br><br />
<br />
<B> Goodies will be served during the meeting (7:00pm @ CAB 373), so be sure to show up! </b><br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 7 ==<br />
<b>Schedule:</b><br />
<br />
AM Crew: MC, JG <b>meeting at 800hrs</b><br><br />
<br />
<b>Lab Notes:</b><br><br />
No growth observed for R0080 overnights; just scrapping it because we have I0500<br><br />
No growth on transformations of BB+DB and BE+DB ligations therefore . . . religated - see masterbook for more details<br><br />
O/N with AMP for I0500<br><br />
Transform religations in to XL10 Gold<br><br />
-MC, JG, ML<br />
<br />
<b>NB: JG has key access</b><br><br />
<br />
<b>To Do:</b><br><br />
Mini preps on I0500 overnights<br><br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 8 ==<br />
<b>Schedule:</b><br />
<br />
Super Awesome Marathon of Productiveness<br />
<br />
8-11:<br />
JG,NG<br />
<br />
11-2:<br />
AL,ML<br />
<br />
2-5:<br />
VH,NK<br />
<br />
5-8:<br />
JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 9 ==<br />
<b>Schedule:</b><br />
<br />
And Yet another super productive Sunday<br />
<br />
8-11: NG and CZ<br />
<br />
NG - Nobody Called me about the key last night (and I completely forgot to swing by: was with parents). So I will wait by the lab either , until the next group shows up or someone with a key. Also bioSci is locked but there is an open door by the physcology wing. I have my cell on 902-8032.<br />
<br />
NG - Update: 9:30am 'broke' into lab :D. Then found key...<br />
<br />
11-2: VH, CZ<br><br />
Nick ran the gel of I0500 restricited by Eco/Spe, but nothing showed up as expected (1.5kb). <br><br />
Digested I0500 and J61003 with Eco/Pst as instructed.<br><br />
<br />
2-5: MC, JG<br><br />
ran gel of restricted I0500 & J61003; unfortunately there is no DNA in the I0500 sample either<br><br />
gel extracted J61003<br><br />
Made LB - to be divided into bottles & autoclaved in G308<br><br />
O/N of DB in BB & DB in BE samples left in 37degree room<br><br />
<br />
5-8: ML, ED<br />
autoclaved little bottles of LB. NOTE: does not need to be autoclaved before you pour it into little bottles and then re-autoclave. Just pour into bottles and autoclave once<br />
digested all in Boos except for DB with Pst/xba<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 10 ==<br />
<b>Schedule:</b><br />
And Scheduling just got hard core<br />
<br />
I have sheduled what we have taken down in the meeting some people appear many times on this schedule working alone just because of the time they were availible. If you are comfortable working alone and taking on lots of shifts im sure the team would be greatful but I'm also sure we would also understand if you didn't want to work alone in the lab. I have only scheduled this way because we need man hours so i tried to fill up all the spots as best i could.<br />
-JG<br />
<br />
MC,JG for the AM<br><br />
put away bottled LB<br><br />
Ran gel of last night's restricted samples "in boo"; did not really turn out<br><br />
ran gel of uncut & single restricted I0500; uncut I0500 showed 2 bands and restricted showed nothing<br><br />
Mini prepped Ligations of DB in BB and DB in BE<br><br />
<br />
to do:<br />
- run gel of double digested I0500<br><br />
- do single & double restriction on Mini prep of Ligations<br><br />
- run gel of uncut, single & double restrictions of mini prepped ligations<br><br />
<br />
ML,AL for the MID <b>(AM crew: What time will you guys be at the lab till? I won't be there until 12:30. Might need to arrange something in order to pick up keys. - AL)</b><br />
<br />
NG (2:30-4) for the PM (celine is in calgary if you dont feel comfortable in the lab by yourself I can show up - JG)<br />
Jason if you have time to show up that would be sweet, but if you don't I understand. -NG<br />
<br />
<br />
<br />
JP,ED for the Night<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 11 ==<br />
<br />
<b>Schedule:</b><br />
No one else really signed up for tuesdays so anyone who has time to drop in should<br />
<br />
AM- NK<br />
<br />
Mid - AL (12:30 - 2 ish), NG (2:00-3:30/4)<br />
<br />
Night- ED JP<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 12 ==<br />
<b>Schedule:</b><br />
<br />
NG <b> Hi guys I have a meeting 3:30 that cannot be reseached I moved myself to come in Tuesday instead (when nobody was in).</b><br />
<br />
AM - <br />
<br />
Mid- ML, AL<br />
<br />
PM - VH (I will be in at about 1PM, if there is something written down for me to do I can work at it by myself, otherwise if someone wants to come in and get me started on something that would be nice.)<br />
<br />
Night - CZ, ED<br><br />
Sorry I have meeting at 6pm which should last no longer than 2 hours, so I will come at 8pm the latest.<br><br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 13 ==<br />
<b>Schedule:</b><br />
<br />
AM-Nik<br />
<br />
PM - VH, JG<br />
<br />
Meeting 7:00<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 14 ==<br />
<br />
<b>Schedule:</b><br />
<br />
<br />
Mid - AL<br />
<br />
PM - VH, CZ<br />
<br />
night - JP<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 15 ==<br />
<b>Schedule:</b><br />
<br />
And yet another crazy weekend...<br />
<br />
8-11 - ED,MC<br />
<br />
11-2 - JG, ML<br />
<br />
2-5 - NG, CZ<br />
<br />
5-8 - NG, ( this is what i had copied down but if anyone else can take this im sure nick would be greatful)<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 16 ==<br />
<b>Schedule:</b><br />
Continued...<br />
<br />
8-11 ED, JG<br />
<br />
11-2 VH, CZ<br />
<br />
2-5 MC, JP<br />
<br />
5-8 - ML, NG<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 17 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 18 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 19 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 20 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 21 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 22 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 26 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
== September 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/September#September|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/August|To August 2007]]<br></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JulyAlberta/Calender/July2007-07-25T18:30:23Z<p>Vhouston: /* July 26 */</p>
<hr />
<div><b>Schedule Legend:</B><br />
JG: Jason, <br />
Mc: Michelle,<br />
ED: Erin,<br />
NG: Nick G.,<br />
NK: Nik K.,<br />
CZ: Celine,<br />
AF: Adam,<br />
Al: Alex,<br />
JB: Jori,<br />
JP: Justin,<br />
VH: Veronica,<br />
<br />
<br />
=='''July'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<br />
<br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/July|July 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_1|1]]</td><br />
<td>[[Alberta/Calender/July#July_2|2]]</td><br />
<td>[[Alberta/Calender/July#July_3|3]]</td><br />
<td>[[Alberta/Calender/July#July_4|4]]</td><br />
<td>[[Alberta/Calender/July#July_5|5]]</td><br />
<td>[[Alberta/Calender/July#July_6|6]]</td><br />
<td>[[Alberta/Calender/July#July_7|7]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_8|8]]</td><br />
<td>[[Alberta/Calender/July#July_9|9]]</td><br />
<td>[[Alberta/Calender/July#July_10|10]]</td><br />
<td>[[Alberta/Calender/July#July_11|11]]</td><br />
<td>[[Alberta/Calender/July#July_12|12]]</td><br />
<td>[[Alberta/Calender/July#July_13|13]]</td><br />
<td>[[Alberta/Calender/July#July_14|14]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_15|15]]</td><br />
<td>[[Alberta/Calender/July#July_16|16]]</td><br />
<td>[[Alberta/Calender/July#July_17|17]]</td><br />
<td>[[Alberta/Calender/July#July_18|18]]</td><br />
<td>[[Alberta/Calender/July#July_19|19]]</td><br />
<td>[[Alberta/Calender/July#July_20|20]]</td><br />
<td>[[Alberta/Calender/July#July_21|21]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_22|22]]</td><br />
<td>[[Alberta/Calender/July#July_23|23]]</td><br />
<td>[[Alberta/Calender/July#July_24|24]]</td><br />
<td>[[Alberta/Calender/July#July_25|25]]</td><br />
<td>[[Alberta/Calender/July#July_26|26]]</td><br />
<td>[[Alberta/Calender/July#July_27|27]]</td><br />
<td>[[Alberta/Calender/July#July_28|28]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_29|29]]</td><br />
<td>[[Alberta/Calender/July#July_30|30]]</td><br />
<td>[[Alberta/Calender/July#July_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<br />
<br />
</tr><br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== July 1 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 3 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 4 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of: J61003 (vector containing GFP), J23119 (constitutive promotor), E1010 (RFP), J45100 (methyl salicylate), 0034 (RBS). Transform into XL10 gold cells. Plate on Amp.<br />
<br />
-ED, JG, ML, MC, VH, AL, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 5 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 6 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformation of E1010 did not work, it is in a Kan vector. SMRT.<br />
<br />
Set up 4X5mL overnights of pSB1A3, J45100, B0034, J61003.<br />
<br />
-ED<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 7 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Glycerol stocks of overnights from July 6. Stored in -80 freezer. Miniprep from overnights started July 6. Stored in "iGEM" freezer box in -20 freezer.<br />
<br />
-JP,JB,AL<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 8 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transform E1010 and A0500 into XL10 Gold. Plate on Kan.<br />
<br />
Pour Kan and Amp plates. Make TBE and TAE buffer.<br />
<br />
-ED, JP, MC, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 9 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Retransform E1010 and A0050 into XL10Gold cells using new plates that were poured Sunday.<br />
<br />
-ED, VH, JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 10 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of E1010 and A0050 were not successful. Tomorrow we will try with a new cell line and enriched media.<br />
<br />
-ED, MC, AF, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 11 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Third attempt at transforming the Kan resistant BioBricks. Transformed E1010, A0500, and pSB2K3 into XL10 Gold, XL10 Gold with enriched media (Magnesium & Glucose), and DH5a cells. Plated 100uL and the pellet remaining after taking the 100uL aliquot on Kan plates.<br />
<br />
Restriction digest of J61003 with Xba and Spe. Run on 0.8% agarose gel. Cut out 2290 band, will gel extract tomorrow.<br />
<br />
<center> [[image: Alberta_e1010xlgold_july11.jpg]] <br />
<br />
E1010 XLGOLD 10 July 11</center><br />
<br />
-ED, MC, NG, JG, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 12 ==<br />
<br />
'''General Notes:'''<br />
<br />
Calender up and running.<br />
<br />
Meeting tonight at 7:00 in CSC 2-49.<br />
<br />
Received Chlorobium tepidum, meeting with Dr. Jeff Fuller (with Capital Health) to discuss the use of their anaerobic chambers!!<br />
-Justin<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations with DH5a cells worked, but we will need to select for single colonies tonight.<br />
<br />
Streak for single colonies of E1010, A0500, J61003.<br />
<br />
Purification of gel slice of digested J61003.<br />
<br />
<br />
<center> [[image: Alberta_e1010DH5a_july12.jpg]] <br />
<br />
E1010 DH5a July 12</center><br />
<br />
-ED, JG, AL, JB, MC, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 13 ==<br />
<br />
'''General Notes:'''<br />
<br />
Everyone who is coming tonight please be present 7:00pm sharp<br />
<br />
'''Lab Notes:'''<br />
<br />
Started 4X5mL overnights of E1010 and I0050 at 8:30 am. Should be ready for miniprep tonight.<br />
<br />
-ED, JB<br />
<br />
No growth in over nights - left these shaking in 37 incubator because they may be "slow growers"<br><br />
Started new overnights of E1010, I0500, and psb2k3 (all DH5alpha) at 2200hrs incubating in the incubator by the autoclave - plates were also streaked (&labeled corresponding to the tubes)<br><br />
Also made overnights for massive colonies seen on 48hr growth of E1010 in XL<br><br />
Made some Kan plates<br><br />
<br />
-MC, JP, JG, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 14 ==<br />
<b>Schedule:</b><br />
<br />
AL,JP,NK<br />
<br />
<b>General Notes:</b><br />
<br />
If you are scheduled during the day please be in the lab at 1230hrs (PM) <br />
Don't forget that the Bio-Sci doors lock at 1900hrs so if you are trying to get in after 1900hrs call 492-2911<br />
<br />
Things to be continued today (CZ)<br><br />
1. Put LB plates in 4 degree fridge <br><br />
2. Plate 20 microlitre of DH5 alpha on a kan plate as a control<br><br />
3. Xba1/EcoRI double digest <br><br />
NOTE: Sequential digestion is needed. Start with 1 microlitre of Xba1 and 2 microlitre of 10x Tango and incubate for an hour. Then add 1 microlitre of EcoRI and 2.5 microlitre of 10X Tango and incubate for an hour. <br><br />
4. Miniprep on the colonies picked on July 13 at 10pm. They are in the shaker in the back room. Note the colonies picked were also streaked on kan plates in the 37 degree incubator. Erin's colonies are in the shaker in the front room.<br><br />
<br />
If you need anything else call me(Celine). Number on the blackboard. Thank you.�<br />
<br />
<b/>Lab Notes:</b><br />
JP, AL, NK, JB(?) <br><br />
<br />
1. Completed Mini on E10050 (4), I0500 (2), PSB2K3 (2) samples (the two labeled Erin, are those from July 13 8:30am ON's) In DNA box -20 <br><br />
2. Completed sequential double restriction on J61003 promoter region. Used Xba1 and EcoR1 (see protocol). sample in DNA box -20 <br><br />
3. Placed Kan plates at +4 <br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 15 ==<br />
<b>Schedule:</b><br />
<br />
Jp,JB,AL<br />
<br />
<b>General Notes:</b><br />
<br />
Options: <br><br />
<br />
1. complete double restriction on newly mini'd plasmids (arabinose promoter, RFP)<br><br />
2. gel purify J61003 restriction products (promoter restriction sample) <br><br />
3. fundraising letters! <br><br />
<br />
<b>Lab Notes:</b><br />
<br />
1. ran a gel containing the digested products of the J61003 (promoter digest), snapped photo and cut out bands for extraction/purification tomorrow<br><br />
2. glycerol stocks of Chlorobium tepidum<br><br />
3. finished grant application forms<br><br />
- JP, AL, NG, MC<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 16 ==<br />
<b>Schedule:</b><br />
<br />
CZ,VH,AF<br />
<br />
<b>General Notes:</b><br />
<br />
1. Because we didn't get into lab till late (because of locked doors), did not complete restriction on newly mini'd plasmids. Can be completed today (isolate arabinose promoter and RFP) <br><br />
2. All of the restriction product (for J61003 XbaI/EcoR1) were ran and cut - no sample remaining <br><br />
<br />
'''Lab Notes:'''<br />
<br />
Completed gel extraction of E,X digested J61003. (in box in -20)<br />
<br />
Restriction digests of E1010 (X,S) and I0500 (E,x), ran on 0.8% gel. E1010 expected a band at 680bp, I0500 expected a band at 1200 bp. Got two positive lanes for E1010: XL1 and XL2 minipreps. Cut out bands and put in -20. No positive for I0500.<br />
<br />
-VH, ED, CZ<br />
<br />
<br />
'''Quotes of the Day:'''<br />
<br />
"If I had a remote, I'd change the cd."<br />
<br />
Anonymous, in response to the skipping music on the cd player, but much to lazy to get up and change it<br />
<br />
"I would never drive this tired. But I WILL operate chemicals."<br />
<br />
Anonymous<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 17 ==<br />
<b>Schedule:</b><br />
<br />
ED,VH,AF<br />
<br />
'''Lab Notes:'''<br />
<br />
Gel extracted E1010 from yesterday's slices.<br />
<br />
Mini-prep on A0500 from a culture labelled with red marker. If anyone knows what cell line is in this culture, please post. <br><br />
<b> It is I0500 and it is DH5alpha unless otherwise labelled . .. only the E1010 had both DH5alpha and XL10gold overnights -MC </b> <br><br />
<br />
Let's not do anything more with it then, because the DH5as aren't working due to them already having their own Kan resistance. - ED<br />
<br />
Ligation of E1010 (RFP) into J61003. Used 4 different ligation conditions. These are sitting on the instructor's bench at the front of the room. These need to be transformed into XL10 Gold and plated on Amp tomorrow. Try transforming 1uL and 10uL.<br />
<br />
-ED,JG,VH,AF<br />
<br />
'''Quote of the Day'''<br />
<br />
"Cancer is an urban myth."<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 18 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,MC,NG<br />
<br />
<b>Lab Notes:</b><br />
<br />
Transformed Ligations 1,2,3,4 into XL10 Gold Competent cells <br><br />
Plated 1ul,10 ul, and 200ul on AMP <br><br />
Incubated @ 37celsius overnight<br><br />
<br />
-MC, NG, CZ<br />
<br />
<b>Quote(s) of the Day:</b><br />
<br />
"Asuuuuuuuuuuuum!!" <br><br />
In response to the awesome; "You're wayyyy to exciting for me right now" <br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 19 ==<br />
<br />
Meeting at 7:00, CAB 373.<br />
<br />
<b>Schedule:</b><br />
<br />
ED,MC,JG<br />
<br />
<b>General Notes</b><br />
<br />
New Schedule is up<br><br />
check out the jar o' love @ the front :) <br><br />
<br />
<b>Lab notes</b><br />
<br />
Started 8X5mL overnights to test colonies of the RFP ligation. Hopefully JB will be available to do minipreps tomorrow. Miniprep protocol is tucked in Master Book.<br />
<br />
-ED,JG,MC<br />
<br />
<b>Quote of the Day </b><br />
<br />
"There is a pee throw up smell it the washroom"<br />
<br />
Reply<br />
<br />
"Someone must be pregnant"<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 20 ==<br />
<b>Schedule:</b><br />
<br />
JG,ED,MC <br><br />
<br />
<b>General Notes:</b><br><br />
<br />
There is now a Jar O' Love in the lab; Please do not drink chemicals from said jar o'love. Check it out - it's at the front on the instructors bench. It's to give shout outs for people who are rocking out and 'taking one for the team'. <br><br />
<br />
<b>Lab Notes:</b><br />
<br />
Miniprep Lig3 (8 samples) overnights - JB<br><br />
Made 1L LB broth (16 bottles) at the back to be put away in the sterile cupboards tomorrow <br><br />
Ran Gel of JB's Minipreps after digestion with Xba and Spe. All of the colonies were positive (band at 1.2 kB).<br><br />
Did some dishes - we should learn how to use the dishwasher<br><br />
<br />
- MC, ED, JG <br><br />
<br />
<b>Quote(s) of the day:</b><br><br />
<br />
"Always use protection when using the Jar O' Love"<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 21 ==<br />
<b>Schedule:</b><br />
<br />
JP,NK,AL<br />
<br />
<b>General Notes:</b><br />
<br />
<br />
Since it doesn't look like Nik will be showing up, maybe just call Alex and see if it works for him.<br />
<br />
All of the ligations of RFP into J61003 turned out. They are labelled JB July 19 1-8 in the DNA box. Transform 1 of them into XL10 Gold and plate on Amp with Tetracycline plates. You will have to add the Tet to the plates beforehand. I don't know what concentraion, but James suggested 1 ug/mL. Try plating different amounts.<br />
<br />
The reason that I am making these suggestions is that I read that XL10Golds are Tet resistant, so we can maybe induce the expression of RFP with the Tet because it is under the Tet promotor and then we can see the RFP.<br />
<br />
As always, call me if you need anything.<br />
<br />
-ED<br />
<br />
<b>Lab Notes:</b><br />
<br />
1. got into building <br><br />
2. waited for peers - no shows <br><br />
3. tried to break into room by climbing through roof (cement goes all the way up) <br><br />
4. went home... will complete work tomorrow - sorry i'll get swipe access asap... <br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 22 ==<br />
<br />
<b>Schedule:</b><br />
<br />
JP,AL,NG<br />
<br />
<b>General Notes:</b><br />
<br />
How does 7:00pm sound?<br />
<br />
<b>Laboratory Notes:</b><br />
<br />
Transformed XL10 gold cells with J61003 (with RFP ligated in). Split cell aliquot into two 50microL aliquots and added 1microL DNA from ligation sample 1 and from ligation sample 4. Covered AMP plates with 50microL 1microg/ml tet, spread, let sit. Plated (1) 50microL sample and (1) 5microL + 45microL LB onto Tet/Amp plates for #'s 1&4. They are in 37C incubator. The remaining transformed cells are in +4C labeled July 22. <br><br />
<br />
<b>Serious Quote of the Month</b><br />
<br />
<b>Faust</b><br><br />
Then shall I see, with vision clear, <br><br />
How secret elements cohere, <br><br />
And what the universe engirds, <br><br />
And give up huckstering with words <br><br />
<br />
-Johann Wolfgang von Goethe <br><br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 23 ==<br />
<br />
<b>Schedule:</b><br />
<br />
VH,CZ,JG<br />
<br />
<b>Laboratory Notes:</b><br><br />
1. Add more Tet on ligation plates from July 22. Hopefully red colonies will appear!<br><br />
2. Transformation of XL10Gold with<br><br />
- Butanol CoA dehydrogenase (1 in 1000 dilution)<br><br />
- Butenoyl CoA dehydrogenase (1 in 1000 dilution)<br><br />
- J23018 (RFP positive control)<br><br />
<br />
20 and 100 microlitres of transformed culture plated on Amp plate and incubate at 37 degrees<br><br />
<br />
The leftover mixture is stored in 4 degree fridge in case of no growth.<br><br />
3. Repeate overnight ligation from July 22. The exact amounts of insert, vector etc. are on the blackboard.<br><br />
<br />
For tomorrow:<br><br />
1. Pick colonies for transformed plates.<br><br />
2. Plate ligation mixtures with appropriate amount of Tet.<br><br />
3. Observe red colonies from the July 22 ligation plates if the cells are still alive.<br><br />
<br />
Memorable Quote:<br><br />
Don't force it. Let it come out naturally.<br><br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 24 ==<br />
<br />
<b>Schedule:</b><br />
<br />
AF,ED,NG<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformed I0500 (arabinose promotor) into HB101 competent cells. Plated 2, 20, 200 uL on Kan.<br />
<br />
Transformed ligations from yesterday into XL10 gold. Plated 100 uL on Amp.<br />
<br />
RFP control from yesterday worked, but sadly our ligations are not expressing any RFP. It was still exciting to see red control cells. It seems as if the Tet promotor is induced at a low level without any Tet.<br />
<br />
Started 4X5ml overnights of enoyl coA hydratase and butyryl coa DH. There seems to be some confusion with the naming of these proteins. These are the names that I have used in the BioBricks. We will be able to tell if they are correctly labelled when we do the digests. Enoyl coa hydratase is about 840 bp and butyryl coa DH is about 1200 bp.<br />
<br />
Note on agarose gels: Use only the wide combs (8 lanes) because we are having to many problems with the narrow lanes. This may mean that you will need to pour multiple gels (oh my). Also, try and run two ladders per gel until we get the ladder problem sorted out. Also, make sure that you zoom in on the gel when taking a picture.<br />
<br />
Note on Tet: should be stored 12.5 mg/mL in 50% ethanol, 50% water solution. This is a 1000X solution. Keep this in mind when using Tet again.<br />
<br />
-ED, AF, James<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 25 ==<br />
<br />
<b>Schedule:</b><br />
<br />
Jp,MC,VH<br />
<br />
<b>General Notes:</b><br />
<br />
Use of wide combs- 5microL of sample works well with 3.5microL of ladder. Make sure you stir up the ladder before use!<br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 26 ==<br />
<br />
Meeting at 7:00, Room CAB 373.<br />
<br />
<b>Schedule:</b><br />
<br />
AL,VH,ED<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 27 ==<br />
<br />
<b>Schedule:</b><br />
<br />
JP,MC,NK<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 28 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,JG,NK<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 29 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,AF,NG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
== July 31 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/June|To June 2007]]<br><br />
[[Alberta/Calender/August|To August 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JulyAlberta/Calender/July2007-07-18T16:41:36Z<p>Vhouston: /* July 19 */</p>
<hr />
<div><b>Schedule Legend:</B><br />
JG: Jason, <br />
Mc: Michelle,<br />
ED: Erin,<br />
NG: Nick G.,<br />
NK: Nik K.,<br />
CZ: Celine,<br />
AF: Adam,<br />
Al: Alex,<br />
JB: Jori,<br />
JP: Justin,<br />
VH: Veronica,<br />
<br />
<br />
=='''July'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<br />
<br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/July|July 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_1|1]]</td><br />
<td>[[Alberta/Calender/July#July_2|2]]</td><br />
<td>[[Alberta/Calender/July#July_3|3]]</td><br />
<td>[[Alberta/Calender/July#July_4|4]]</td><br />
<td>[[Alberta/Calender/July#July_5|5]]</td><br />
<td>[[Alberta/Calender/July#July_6|6]]</td><br />
<td>[[Alberta/Calender/July#July_7|7]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_8|8]]</td><br />
<td>[[Alberta/Calender/July#July_9|9]]</td><br />
<td>[[Alberta/Calender/July#July_10|10]]</td><br />
<td>[[Alberta/Calender/July#July_11|11]]</td><br />
<td>[[Alberta/Calender/July#July_12|12]]</td><br />
<td>[[Alberta/Calender/July#July_13|13]]</td><br />
<td>[[Alberta/Calender/July#July_14|14]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_15|15]]</td><br />
<td>[[Alberta/Calender/July#July_16|16]]</td><br />
<td>[[Alberta/Calender/July#July_17|17]]</td><br />
<td>[[Alberta/Calender/July#July_18|18]]</td><br />
<td>[[Alberta/Calender/July#July_19|19]]</td><br />
<td>[[Alberta/Calender/July#July_20|20]]</td><br />
<td>[[Alberta/Calender/July#July_21|21]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_22|22]]</td><br />
<td>[[Alberta/Calender/July#July_23|23]]</td><br />
<td>[[Alberta/Calender/July#July_24|24]]</td><br />
<td>[[Alberta/Calender/July#July_25|25]]</td><br />
<td>[[Alberta/Calender/July#July_26|26]]</td><br />
<td>[[Alberta/Calender/July#July_27|27]]</td><br />
<td>[[Alberta/Calender/July#July_28|28]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_29|29]]</td><br />
<td>[[Alberta/Calender/July#July_30|30]]</td><br />
<td>[[Alberta/Calender/July#July_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<br />
<br />
</tr><br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== July 1 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 3 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 4 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of: J61003 (vector containing GFP), J23119 (constitutive promotor), E1010 (RFP), J45100 (methyl salicylate), 0034 (RBS). Transform into XL10 gold cells. Plate on Amp.<br />
<br />
-ED, JG, ML, MC, VH, AL, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 5 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 6 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformation of E1010 did not work, it is in a Kan vector. SMRT.<br />
<br />
Set up 4X5mL overnights of pSB1A3, J45100, B0034, J61003.<br />
<br />
-ED<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 7 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Glycerol stocks of overnights from July 6. Stored in -80 freezer. Miniprep from overnights started July 6. Stored in "iGEM" freezer box in -20 freezer.<br />
<br />
-JP,JB,AL<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 8 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transform E1010 and A0500 into XL10 Gold. Plate on Kan.<br />
<br />
Pour Kan and Amp plates. Make TBE and TAE buffer.<br />
<br />
-ED, JP, MC, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 9 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Retransform E1010 and A0050 into XL10Gold cells using new plates that were poured Sunday.<br />
<br />
-ED, VH, JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 10 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of E1010 and A0050 were not successful. Tomorrow we will try with a new cell line and enriched media.<br />
<br />
-ED, MC, AF, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 11 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Third attempt at transforming the Kan resistant BioBricks. Transformed E1010, A0500, and pSB2K3 into XL10 Gold, XL10 Gold with enriched media (Magnesium & Glucose), and DH5a cells. Plated 100uL and the pellet remaining after taking the 100uL aliquot on Kan plates.<br />
<br />
Restriction digest of J61003 with Xba and Spe. Run on 0.8% agarose gel. Cut out 2290 band, will gel extract tomorrow.<br />
<br />
-ED, MC, NG, JG, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 12 ==<br />
<br />
'''General Notes:'''<br />
<br />
Calender up and running.<br />
<br />
Meeting tonight at 7:00 in CSC 2-49.<br />
<br />
Received Chlorobium tepidum, meeting with Dr. Jeff Fuller (with Capital Health) to discuss the use of their anaerobic chambers!!<br />
-Justin<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations with DH5a cells worked, but we will need to select for single colonies tonight.<br />
<br />
Streak for single colonies of E1010, A0500, J61003.<br />
<br />
Purification of gel slice of digested J61003.<br />
<br />
-ED, JG, AL, JB, MC, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 13 ==<br />
<br />
'''General Notes:'''<br />
<br />
Everyone who is coming tonight please be present 7:00pm sharp<br />
<br />
'''Lab Notes:'''<br />
<br />
Started 4X5mL overnights of E1010 and I0050 at 8:30 am. Should be ready for miniprep tonight.<br />
<br />
-ED, JB<br />
<br />
No growth in over nights - left these shaking in 37 incubator because they may be "slow growers"<br><br />
Started new overnights of E1010, I0500, and psb2k3 (all DH5alpha) at 2200hrs incubating in the incubator by the autoclave - plates were also streaked (&labeled corresponding to the tubes)<br><br />
Also made overnights for massive colonies seen on 48hr growth of E1010 in XL<br><br />
Made some Kan plates<br><br />
<br />
-MC, JP, JG, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 14 ==<br />
<b>Schedule:</b><br />
<br />
AL,JP,NK<br />
<br />
<b>General Notes:</b><br />
<br />
If you are scheduled during the day please be in the lab at 1230hrs (PM) <br />
Don't forget that the Bio-Sci doors lock at 1900hrs so if you are trying to get in after 1900hrs call 492-2911<br />
<br />
Things to be continued today (CZ)<br><br />
1. Put LB plates in 4 degree fridge <br><br />
2. Plate 20 microlitre of DH5 alpha on a kan plate as a control<br><br />
3. Xba1/EcoRI double digest <br><br />
NOTE: Sequential digestion is needed. Start with 1 microlitre of Xba1 and 2 microlitre of 10x Tango and incubate for an hour. Then add 1 microlitre of EcoRI and 2.5 microlitre of 10X Tango and incubate for an hour. <br><br />
4. Miniprep on the colonies picked on July 13 at 10pm. They are in the shaker in the back room. Note the colonies picked were also streaked on kan plates in the 37 degree incubator. Erin's colonies are in the shaker in the front room.<br><br />
<br />
If you need anything else call me(Celine). Number on the blackboard. Thank you.�<br />
<br />
<b/>Lab Notes:</b><br />
JP, AL, NK, JB(?) <br><br />
<br />
1. Completed Mini on E10050 (4), I0500 (2), PSB2K3 (2) samples (the two labeled Erin, are those from July 13 8:30am ON's) In DNA box -20 <br><br />
2. Completed sequential double restriction on J61003 promoter region. Used Xba1 and EcoR1 (see protocol). sample in DNA box -20 <br><br />
3. Placed Kan plates at +4 <br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 15 ==<br />
<b>Schedule:</b><br />
<br />
Jp,JB,AL<br />
<br />
<b>General Notes:</b><br />
<br />
Options: <br><br />
<br />
1. complete double restriction on newly mini'd plasmids (arabinose promoter, RFP)<br><br />
2. gel purify J61003 restriction products (promoter restriction sample) <br><br />
3. fundraising letters! <br><br />
<br />
<b>Lab Notes:</b><br />
<br />
1. ran a gel containing the digested products of the J61003 (promoter digest), snapped photo and cut out bands for extraction/purification tomorrow<br><br />
2. glycerol stocks of Chlorobium tepidum<br><br />
3. finished grant application forms<br><br />
- JP, AL, NG, MC<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 16 ==<br />
<b>Schedule:</b><br />
<br />
CZ,VH,AF<br />
<br />
<b>General Notes:</b><br />
<br />
1. Because we didn't get into lab till late (because of locked doors), did not complete restriction on newly mini'd plasmids. Can be completed today (isolate arabinose promoter and RFP) <br><br />
2. All of the restriction product (for J61003 XbaI/EcoR1) were ran and cut - no sample remaining <br><br />
<br />
'''Lab Notes:'''<br />
<br />
Completed gel extraction of E,X digested J61003. (in box in -20)<br />
<br />
Restriction digests of E1010 (X,S) and I0500 (E,x), ran on 0.8% gel. E1010 expected a band at 680bp, I0500 expected a band at 1200 bp. Got two positive lanes for E1010: XL1 and XL2 minipreps. Cut out bands and put in -20. No positive for I0500.<br />
<br />
-VH, ED, CZ<br />
<br />
<br />
'''Quotes of the Day:'''<br />
<br />
"If I had a remote, I'd change the cd."<br />
<br />
Anonymous, in response to the skipping music on the cd player, but much to lazy to get up and change it<br />
<br />
"I would never drive this tired. But I WILL operate chemicals."<br />
<br />
Anonymous<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 17 ==<br />
<b>Schedule:</b><br />
<br />
ED,VH,AF<br />
<br />
'''Lab Notes:'''<br />
<br />
Gel extracted E1010 from yesterday's slices.<br />
<br />
Mini-prep on A0500 from a culture labelled with red marker. If anyone knows what cell line is in this culture, please post. <br><br />
<b> It is I0500 and it is DH5alpha unless otherwise labelled . .. only the E1010 had both DH5alpha and XL10gold overnights -MC </b> <br><br />
<br />
Let's not do anything more with it then, because the DH5as aren't working due to them already having their own Kan resistance. - ED<br />
<br />
Ligation of E1010 (RFP) into J61003. Used 4 different ligation conditions. These are sitting on the instructor's bench at the front of the room. These need to be transformed into XL10 Gold and plated on Amp tomorrow. Try transforming 1uL and 10uL.<br />
<br />
-ED,JG,VH,AF<br />
<br />
'''Quote of the Day'''<br />
<br />
"Cancer is an urban myth."<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 18 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,MC,NG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 19 ==<br />
<br />
Meeting at 7:00, CAB 373.<br />
<br />
<b>Schedule:</b><br />
<br />
ED,MC,JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 20 ==<br />
<b>Schedule:</b><br />
<br />
JG,ED,MC<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 21 ==<br />
<b>Schedule:</b><br />
<br />
JP,NK,NG<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 22 ==<br />
<br />
<b>Schedule:</b><br />
<br />
JP,AL,NK<br />
<br />
AL: Sorry guys, but I won't be available this Sunday for the lab due to staff meeting at work, can anyone swap with me?<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 26 ==<br />
<br />
Meeting at 7:00, Room TBA.<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
== July 31 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/June|To June 2007]]<br><br />
[[Alberta/Calender/August|To August 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JulyAlberta/Calender/July2007-07-17T15:20:12Z<p>Vhouston: /* July 19 */</p>
<hr />
<div><b>Schedule Legend:</B><br />
JG: Jason, <br />
Mc: Michelle,<br />
ED: Erin,<br />
NG: Nick G.,<br />
NK: Nik K.,<br />
CZ: Celine,<br />
AF: Adam,<br />
Al: Alex,<br />
JB: Jori,<br />
JP: Justin,<br />
VH: Veronica,<br />
<br />
<br />
=='''July'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<br />
<br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/July|July 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_1|1]]</td><br />
<td>[[Alberta/Calender/July#July_2|2]]</td><br />
<td>[[Alberta/Calender/July#July_3|3]]</td><br />
<td>[[Alberta/Calender/July#July_4|4]]</td><br />
<td>[[Alberta/Calender/July#July_5|5]]</td><br />
<td>[[Alberta/Calender/July#July_6|6]]</td><br />
<td>[[Alberta/Calender/July#July_7|7]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_8|8]]</td><br />
<td>[[Alberta/Calender/July#July_9|9]]</td><br />
<td>[[Alberta/Calender/July#July_10|10]]</td><br />
<td>[[Alberta/Calender/July#July_11|11]]</td><br />
<td>[[Alberta/Calender/July#July_12|12]]</td><br />
<td>[[Alberta/Calender/July#July_13|13]]</td><br />
<td>[[Alberta/Calender/July#July_14|14]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_15|15]]</td><br />
<td>[[Alberta/Calender/July#July_16|16]]</td><br />
<td>[[Alberta/Calender/July#July_17|17]]</td><br />
<td>[[Alberta/Calender/July#July_18|18]]</td><br />
<td>[[Alberta/Calender/July#July_19|19]]</td><br />
<td>[[Alberta/Calender/July#July_20|20]]</td><br />
<td>[[Alberta/Calender/July#July_21|21]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_22|22]]</td><br />
<td>[[Alberta/Calender/July#July_23|23]]</td><br />
<td>[[Alberta/Calender/July#July_24|24]]</td><br />
<td>[[Alberta/Calender/July#July_25|25]]</td><br />
<td>[[Alberta/Calender/July#July_26|26]]</td><br />
<td>[[Alberta/Calender/July#July_27|27]]</td><br />
<td>[[Alberta/Calender/July#July_28|28]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_29|29]]</td><br />
<td>[[Alberta/Calender/July#July_30|30]]</td><br />
<td>[[Alberta/Calender/July#July_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<br />
<br />
</tr><br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== July 1 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 3 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 4 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of: J61003 (vector containing GFP), J23119 (constitutive promotor), E1010 (RFP), J45100 (methyl salicylate), 0034 (RBS). Transform into XL10 gold cells. Plate on Amp.<br />
<br />
-ED, JG, ML, MC, VH, AL, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 5 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 6 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformation of E1010 did not work, it is in a Kan vector. SMRT.<br />
<br />
Set up 4X5mL overnights of pSB1A3, J45100, B0034, J61003.<br />
<br />
-ED<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 7 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Glycerol stocks of overnights from July 6. Stored in -80 freezer. Miniprep from overnights started July 6. Stored in "iGEM" freezer box in -20 freezer.<br />
<br />
-JP,JB,AL<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 8 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transform E1010 and A0500 into XL10 Gold. Plate on Kan.<br />
<br />
Pour Kan and Amp plates. Make TBE and TAE buffer.<br />
<br />
-ED, JP, MC, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 9 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Retransform E1010 and A0050 into XL10Gold cells using new plates that were poured Sunday.<br />
<br />
-ED, VH, JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 10 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of E1010 and A0050 were not successful. Tomorrow we will try with a new cell line and enriched media.<br />
<br />
-ED, MC, AF, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 11 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Third attempt at transforming the Kan resistant BioBricks. Transformed E1010, A0500, and pSB2K3 into XL10 Gold, XL10 Gold with enriched media (Magnesium & Glucose), and DH5a cells. Plated 100uL and the pellet remaining after taking the 100uL aliquot on Kan plates.<br />
<br />
Restriction digest of J61003 with Xba and Spe. Run on 0.8% agarose gel. Cut out 2290 band, will gel extract tomorrow.<br />
<br />
-ED, MC, NG, JG, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 12 ==<br />
<br />
'''General Notes:'''<br />
<br />
Calender up and running.<br />
<br />
Meeting tonight at 7:00 in CSC 2-49.<br />
<br />
Received Chlorobium tepidum, meeting with Dr. Jeff Fuller (with Capital Health) to discuss the use of their anaerobic chambers!!<br />
-Justin<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations with DH5a cells worked, but we will need to select for single colonies tonight.<br />
<br />
Streak for single colonies of E1010, A0500, J61003.<br />
<br />
Purification of gel slice of digested J61003.<br />
<br />
-ED, JG, AL, JB, MC, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 13 ==<br />
<br />
'''General Notes:'''<br />
<br />
Everyone who is coming tonight please be present 7:00pm sharp<br />
<br />
'''Lab Notes:'''<br />
<br />
Started 4X5mL overnights of E1010 and I0050 at 8:30 am. Should be ready for miniprep tonight.<br />
<br />
-ED, JB<br />
<br />
No growth in over nights - left these shaking in 37 incubator because they may be "slow growers"<br><br />
Started new overnights of E1010, I0500, and psb2k3 (all DH5alpha) at 2200hrs incubating in the incubator by the autoclave - plates were also streaked (&labeled corresponding to the tubes)<br><br />
Also made overnights for massive colonies seen on 48hr growth of E1010 in XL<br><br />
Made some Kan plates<br><br />
<br />
-MC, JP, JG, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 14 ==<br />
<b>Schedule:</b><br />
<br />
AL,JP,NK<br />
<br />
<b>General Notes:</b><br />
<br />
If you are scheduled during the day please be in the lab at 1230hrs (PM) <br />
Don't forget that the Bio-Sci doors lock at 1900hrs so if you are trying to get in after 1900hrs call 492-2911<br />
<br />
Things to be continued today (CZ)<br><br />
1. Put LB plates in 4 degree fridge <br><br />
2. Plate 20 microlitre of DH5 alpha on a kan plate as a control<br><br />
3. Xba1/EcoRI double digest <br><br />
NOTE: Sequential digestion is needed. Start with 1 microlitre of Xba1 and 2 microlitre of 10x Tango and incubate for an hour. Then add 1 microlitre of EcoRI and 2.5 microlitre of 10X Tango and incubate for an hour. <br><br />
4. Miniprep on the colonies picked on July 13 at 10pm. They are in the shaker in the back room. Note the colonies picked were also streaked on kan plates in the 37 degree incubator. Erin's colonies are in the shaker in the front room.<br><br />
<br />
If you need anything else call me(Celine). Number on the blackboard. Thank you.�<br />
<br />
<b/>Lab Notes:</b><br />
JP, AL, NK, JB(?) <br><br />
<br />
1. Completed Mini on E10050 (4), I0500 (2), PSB2K3 (2) samples (the two labeled Erin, are those from July 13 8:30am ON's) In DNA box -20 <br><br />
2. Completed sequential double restriction on J61003 promoter region. Used Xba1 and EcoR1 (see protocol). sample in DNA box -20 <br><br />
3. Placed Kan plates at +4 <br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 15 ==<br />
<b>Schedule:</b><br />
<br />
Jp,JB,AL<br />
<br />
<b>General Notes:</b><br />
<br />
Options: <br><br />
<br />
1. complete double restriction on newly mini'd plasmids (arabinose promoter, RFP)<br><br />
2. gel purify J61003 restriction products (promoter restriction sample) <br><br />
3. fundraising letters! <br><br />
<br />
<b>Lab Notes:</b><br />
<br />
1. ran a gel containing the digested products of the J61003 (promoter digest), snapped photo and cut out bands for extraction/purification tomorrow<br><br />
2. glycerol stocks of Chlorobium tepidum<br><br />
3. finished grant application forms<br><br />
- JP, AL, NG, MC<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 16 ==<br />
<b>Schedule:</b><br />
<br />
CZ,ED,VH,AF<br />
<br />
<b>General Notes:</b><br />
<br />
1. Because we didn't get into lab till late (because of locked doors), did not complete restriction on newly mini'd plasmids. Can be completed today (isolate arabinose promoter and RFP) <br><br />
2. All of the restriction product (for J61003 XbaI/EcoR1) were ran and cut - no sample remaining <br><br />
<br />
'''Lab Notes:'''<br />
<br />
Completed gel extraction of E,X digested J61003. (in box in -20)<br />
<br />
Restriction digests of E1010 (X,S) and I0500 (E,x), ran on 0.8% gel. E1010 expected a band at 680bp, I0500 expected a band at 1200 bp. Got two positive lanes for E1010: XL1 and XL2 minipreps. Cut out bands and put in -20. No positive for I0500.<br />
<br />
-VH, ED, CZ<br />
<br />
<br />
'''Quotes of the Day:'''<br />
<br />
"If I had a remote, I'd change the cd."<br />
<br />
Anonymous, in response to the skipping music on the cd player, but much to lazy to get up and change it<br />
<br />
"I would never drive this tired. But I WILL operate chemicals."<br />
<br />
Anonymous<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 17 ==<br />
<b>Schedule:</b><br />
<br />
ED,VH,AF<br />
<br />
'''Lab Notes:'''<br />
<br />
Repeat I0500 with XL10 gold with lower concentration of Kan in plates?<br />
<br />
Ligation of E1010 (RFP) into J61003.<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 18 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,MC,NG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 19 ==<br />
<br />
Meeting at 7:00, Room TBA.<br />
<br />
<b>Schedule:</b><br />
<br />
ED,MC,JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 20 ==<br />
<b>Schedule:</b><br />
<br />
JG,ED,MC<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 21 ==<br />
<b>Schedule:</b><br />
<br />
JP,NK,NG<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 22 ==<br />
<br />
<b>Schedule:</b><br />
<br />
JP,AL,NK<br />
<br />
AL: Sorry guys, but I won't be available this Sunday for the lab due to staff meeting at work, can anyone swap with me?<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 26 ==<br />
<br />
Meeting at 7:00, Room TBA.<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
== July 31 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/June|To June 2007]]<br><br />
[[Alberta/Calender/August|To August 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JulyAlberta/Calender/July2007-07-17T15:19:42Z<p>Vhouston: /* July 17 */</p>
<hr />
<div><b>Schedule Legend:</B><br />
JG: Jason, <br />
Mc: Michelle,<br />
ED: Erin,<br />
NG: Nick G.,<br />
NK: Nik K.,<br />
CZ: Celine,<br />
AF: Adam,<br />
Al: Alex,<br />
JB: Jori,<br />
JP: Justin,<br />
VH: Veronica,<br />
<br />
<br />
=='''July'''==<br />
<br />
<div valign="center"> <br />
<table><tr><td><table style="<br />
font-family: Verdana, Arial, Helvetica, sans-serif;<br />
vertical-align:middle;<br />
text-align:center;<br />
background-color:white;<br />
border-color:#FFFFFF;<br />
border-width:1px;<br />
color:black;<br />
font-size: 12px;"><br />
<tr><br />
<br />
<br />
<td colspan="7" style="font-weight: bold;<br />
width:170px;<br />
height:24px;<br />
color: black;">[[Alberta/Calender/July|July 2007]]</td><br />
</tr><br />
<tr><br />
<td>Su</td><br />
<td>M</td><br />
<td>Tu</td><br />
<td>W</td><br />
<td>Th</td><br />
<td>F</td><br />
<td>Sa</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_1|1]]</td><br />
<td>[[Alberta/Calender/July#July_2|2]]</td><br />
<td>[[Alberta/Calender/July#July_3|3]]</td><br />
<td>[[Alberta/Calender/July#July_4|4]]</td><br />
<td>[[Alberta/Calender/July#July_5|5]]</td><br />
<td>[[Alberta/Calender/July#July_6|6]]</td><br />
<td>[[Alberta/Calender/July#July_7|7]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_8|8]]</td><br />
<td>[[Alberta/Calender/July#July_9|9]]</td><br />
<td>[[Alberta/Calender/July#July_10|10]]</td><br />
<td>[[Alberta/Calender/July#July_11|11]]</td><br />
<td>[[Alberta/Calender/July#July_12|12]]</td><br />
<td>[[Alberta/Calender/July#July_13|13]]</td><br />
<td>[[Alberta/Calender/July#July_14|14]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_15|15]]</td><br />
<td>[[Alberta/Calender/July#July_16|16]]</td><br />
<td>[[Alberta/Calender/July#July_17|17]]</td><br />
<td>[[Alberta/Calender/July#July_18|18]]</td><br />
<td>[[Alberta/Calender/July#July_19|19]]</td><br />
<td>[[Alberta/Calender/July#July_20|20]]</td><br />
<td>[[Alberta/Calender/July#July_21|21]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_22|22]]</td><br />
<td>[[Alberta/Calender/July#July_23|23]]</td><br />
<td>[[Alberta/Calender/July#July_24|24]]</td><br />
<td>[[Alberta/Calender/July#July_25|25]]</td><br />
<td>[[Alberta/Calender/July#July_26|26]]</td><br />
<td>[[Alberta/Calender/July#July_27|27]]</td><br />
<td>[[Alberta/Calender/July#July_28|28]]</td><br />
</tr><br />
<tr><br />
<td>[[Alberta/Calender/July#July_29|29]]</td><br />
<td>[[Alberta/Calender/July#July_30|30]]</td><br />
<td>[[Alberta/Calender/July#July_31|31]]</td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<td></td><br />
<br />
<br />
</tr><br />
</table></td><td><br />
</td></tr></table></div><br />
<br />
<br />
<br />
To [[Alberta/Calender/August|August 2007]]<br><br />
Back to [[Alberta|UofA iGEM Home]]<br><br />
<br />
== July 1 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 2 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 3 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 4 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of: J61003 (vector containing GFP), J23119 (constitutive promotor), E1010 (RFP), J45100 (methyl salicylate), 0034 (RBS). Transform into XL10 gold cells. Plate on Amp.<br />
<br />
-ED, JG, ML, MC, VH, AL, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 5 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 6 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformation of E1010 did not work, it is in a Kan vector. SMRT.<br />
<br />
Set up 4X5mL overnights of pSB1A3, J45100, B0034, J61003.<br />
<br />
-ED<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 7 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Glycerol stocks of overnights from July 6. Stored in -80 freezer. Miniprep from overnights started July 6. Stored in "iGEM" freezer box in -20 freezer.<br />
<br />
-JP,JB,AL<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 8 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transform E1010 and A0500 into XL10 Gold. Plate on Kan.<br />
<br />
Pour Kan and Amp plates. Make TBE and TAE buffer.<br />
<br />
-ED, JP, MC, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 9 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Retransform E1010 and A0050 into XL10Gold cells using new plates that were poured Sunday.<br />
<br />
-ED, VH, JG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 10 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations of E1010 and A0050 were not successful. Tomorrow we will try with a new cell line and enriched media.<br />
<br />
-ED, MC, AF, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 11 ==<br />
<br />
'''Lab Notes:'''<br />
<br />
Third attempt at transforming the Kan resistant BioBricks. Transformed E1010, A0500, and pSB2K3 into XL10 Gold, XL10 Gold with enriched media (Magnesium & Glucose), and DH5a cells. Plated 100uL and the pellet remaining after taking the 100uL aliquot on Kan plates.<br />
<br />
Restriction digest of J61003 with Xba and Spe. Run on 0.8% agarose gel. Cut out 2290 band, will gel extract tomorrow.<br />
<br />
-ED, MC, NG, JG, VH, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 12 ==<br />
<br />
'''General Notes:'''<br />
<br />
Calender up and running.<br />
<br />
Meeting tonight at 7:00 in CSC 2-49.<br />
<br />
Received Chlorobium tepidum, meeting with Dr. Jeff Fuller (with Capital Health) to discuss the use of their anaerobic chambers!!<br />
-Justin<br />
<br />
'''Lab Notes:'''<br />
<br />
Transformations with DH5a cells worked, but we will need to select for single colonies tonight.<br />
<br />
Streak for single colonies of E1010, A0500, J61003.<br />
<br />
Purification of gel slice of digested J61003.<br />
<br />
-ED, JG, AL, JB, MC, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 13 ==<br />
<br />
'''General Notes:'''<br />
<br />
Everyone who is coming tonight please be present 7:00pm sharp<br />
<br />
'''Lab Notes:'''<br />
<br />
Started 4X5mL overnights of E1010 and I0050 at 8:30 am. Should be ready for miniprep tonight.<br />
<br />
-ED, JB<br />
<br />
No growth in over nights - left these shaking in 37 incubator because they may be "slow growers"<br><br />
Started new overnights of E1010, I0500, and psb2k3 (all DH5alpha) at 2200hrs incubating in the incubator by the autoclave - plates were also streaked (&labeled corresponding to the tubes)<br><br />
Also made overnights for massive colonies seen on 48hr growth of E1010 in XL<br><br />
Made some Kan plates<br><br />
<br />
-MC, JP, JG, CZ<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 14 ==<br />
<b>Schedule:</b><br />
<br />
AL,JP,NK<br />
<br />
<b>General Notes:</b><br />
<br />
If you are scheduled during the day please be in the lab at 1230hrs (PM) <br />
Don't forget that the Bio-Sci doors lock at 1900hrs so if you are trying to get in after 1900hrs call 492-2911<br />
<br />
Things to be continued today (CZ)<br><br />
1. Put LB plates in 4 degree fridge <br><br />
2. Plate 20 microlitre of DH5 alpha on a kan plate as a control<br><br />
3. Xba1/EcoRI double digest <br><br />
NOTE: Sequential digestion is needed. Start with 1 microlitre of Xba1 and 2 microlitre of 10x Tango and incubate for an hour. Then add 1 microlitre of EcoRI and 2.5 microlitre of 10X Tango and incubate for an hour. <br><br />
4. Miniprep on the colonies picked on July 13 at 10pm. They are in the shaker in the back room. Note the colonies picked were also streaked on kan plates in the 37 degree incubator. Erin's colonies are in the shaker in the front room.<br><br />
<br />
If you need anything else call me(Celine). Number on the blackboard. Thank you.�<br />
<br />
<b/>Lab Notes:</b><br />
JP, AL, NK, JB(?) <br><br />
<br />
1. Completed Mini on E10050 (4), I0500 (2), PSB2K3 (2) samples (the two labeled Erin, are those from July 13 8:30am ON's) In DNA box -20 <br><br />
2. Completed sequential double restriction on J61003 promoter region. Used Xba1 and EcoR1 (see protocol). sample in DNA box -20 <br><br />
3. Placed Kan plates at +4 <br><br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 15 ==<br />
<b>Schedule:</b><br />
<br />
Jp,JB,AL<br />
<br />
<b>General Notes:</b><br />
<br />
Options: <br><br />
<br />
1. complete double restriction on newly mini'd plasmids (arabinose promoter, RFP)<br><br />
2. gel purify J61003 restriction products (promoter restriction sample) <br><br />
3. fundraising letters! <br><br />
<br />
<b>Lab Notes:</b><br />
<br />
1. ran a gel containing the digested products of the J61003 (promoter digest), snapped photo and cut out bands for extraction/purification tomorrow<br><br />
2. glycerol stocks of Chlorobium tepidum<br><br />
3. finished grant application forms<br><br />
- JP, AL, NG, MC<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 16 ==<br />
<b>Schedule:</b><br />
<br />
CZ,ED,VH,AF<br />
<br />
<b>General Notes:</b><br />
<br />
1. Because we didn't get into lab till late (because of locked doors), did not complete restriction on newly mini'd plasmids. Can be completed today (isolate arabinose promoter and RFP) <br><br />
2. All of the restriction product (for J61003 XbaI/EcoR1) were ran and cut - no sample remaining <br><br />
<br />
'''Lab Notes:'''<br />
<br />
Completed gel extraction of E,X digested J61003. (in box in -20)<br />
<br />
Restriction digests of E1010 (X,S) and I0500 (E,x), ran on 0.8% gel. E1010 expected a band at 680bp, I0500 expected a band at 1200 bp. Got two positive lanes for E1010: XL1 and XL2 minipreps. Cut out bands and put in -20. No positive for I0500.<br />
<br />
-VH, ED, CZ<br />
<br />
<br />
'''Quotes of the Day:'''<br />
<br />
"If I had a remote, I'd change the cd."<br />
<br />
Anonymous, in response to the skipping music on the cd player, but much to lazy to get up and change it<br />
<br />
"I would never drive this tired. But I WILL operate chemicals."<br />
<br />
Anonymous<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 17 ==<br />
<b>Schedule:</b><br />
<br />
ED,VH,AF<br />
<br />
'''Lab Notes:'''<br />
<br />
Repeat I0500 with XL10 gold with lower concentration of Kan in plates?<br />
<br />
Ligation of E1010 (RFP) into J61003.<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 18 ==<br />
<br />
<b>Schedule:</b><br />
<br />
CZ,MC,NG<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 19 ==<br />
<br />
Meeting at 7:00, Room TBA.<br />
<br />
<b>Schedule:</b><br />
<br />
ED,MC,VH<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 20 ==<br />
<b>Schedule:</b><br />
<br />
JG,ED,MC<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 21 ==<br />
<b>Schedule:</b><br />
<br />
JP,NK,NG<br />
<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 22 ==<br />
<br />
<b>Schedule:</b><br />
<br />
JP,AL,NK<br />
<br />
AL: Sorry guys, but I won't be available this Sunday for the lab due to staff meeting at work, can anyone swap with me?<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 23 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 24 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 25 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 26 ==<br />
<br />
Meeting at 7:00, Room TBA.<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 27 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 28 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 29 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
== July 30 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
== July 31 ==<br />
<br />
<br />
<br />
[[Alberta/Calender/July#July|to the top]]<br />
<br />
<br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/June|To June 2007]]<br><br />
[[Alberta/Calender/August|To August 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/File:Alberta_Veronica.jpgFile:Alberta Veronica.jpg2007-07-06T14:50:14Z<p>Vhouston: </p>
<hr />
<div></div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/MembersAlberta/Members2007-07-06T14:49:19Z<p>Vhouston: </p>
<hr />
<div>== '''University of Alberta 2007 iGEM Team Members''' ==<br />
<br />
<h2> Student Members </h2><br />
<br />
We are fortunate to have a wide range of expertise with facets in biology, biochemistry, genetics and engineering. Student memebers include:<br />
<br />
[[Image:Alberta_jori.jpg|thumb|180px|left|[[Jori Bolton|Jori Bolton: 2nd year Molecular Genetics]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Michelle Chan|Michelle Chan: 4th Year Biology]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Erin Dul|Erin Dul: 4th Year in Biochemistry]]]]<br />
[[Image:Alberta_andrew.jpg|thumb|180px|left|[[Adam Foster|Adam Foster: 4th year Genetics]]]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
[[Image:blank.jpg|thumb|180px|left|[[Jason Gardiner|Jason Gardiner: Third Year Biology Specialization in Botany]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Nick Glass|Nick Glass: BSc. in Mech Eng, 1st year of MSc. in Elect Eng]]]]<br />
[[Image:Alberta_Veronica.jpg|thumb|180px|left|[[Veronica Houston|Veronica Houston: 5th year of Mechanical Engineering Coop]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Nik Kumar|Nik Kumar: 3rd year in Biological Sciences]]]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
[[Image:blank.jpg|thumb|180px|left|[[Matt Lafleche|Matt LaFleche: 4th year Engineering Physics]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Alex Lam|Alex Lam: 4th year Pharmacology]]]]<br />
[[Image:Alberta_justin.jpg|thumb|180px|left|[[Justin Pahara|Justin Pahara: Bsc. Immunology and Infection, 2nd years MSc. Cell Bio]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Celine Zeng|Celine Zeng: 3rd year of Honors Pharmacology]]]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
<h2> Advisors </h2><br />
<br />
We are fortunate enough to have the following advisors to assist our team throughout the course of the project.<br />
<br />
[[Image:blank.jpg|thumb|180px|left|[[Perrin Beatty|Dr. Perrin Beatty, Department of Microbiology]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Jon Dennis|Dr. Jon Dennis, Associate Professor with the Department of Biological Sciences]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Mike Deyholos|Dr. Mike Deyholos, Associate Professor with the Department of Biological Sciences ]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[James Maclagan|James Maclagan, Genetics Lab Instructor]]]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
[[Image:blank.jpg|thumb|180px|left|[[Wayne Materi|Dr. Wayne Materi, Assistant Research Officer with the National Institute for Nanotechnology]]]]<br />
[[Image:blank.jpg|thumb|180px|left|[[Doug Ridgway|Dr. Doug Ridgway, Research Associate with the Institue for Biomolecular Design]]]]<br />
<br />
<br><br><br><br><br><br><br><br><br><br><br><br><br><br><br />
<br />
Back to the [[Alberta|UofA iGEM Homepage]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JuneAlberta/Calender/June2007-06-28T19:54:05Z<p>Vhouston: </p>
<hr />
<div><html><HEAD><TITLE>Untitled Document</TITLE><br />
<META http-equiv=Content-Type content="text/html; charset=iso-8859-1"><br />
<META content="MSHTML 6.00.2900.3086" name=GENERATOR></HEAD><br />
<BODY><br />
<TABLE height=586 cellSpacing=0 borderColorDark=#000000 cellPadding=2 <br />
width="95%" align=center border=1><br />
<TBODY><br />
<TR><br />
<TD align=middle colSpan=7 height=35><br />
<H3>June&nbsp;&nbsp;2007</H3></TD></TR><br />
<TR><br />
<TD align=middle>Sun</TD><br />
<TD align=middle>Mon</TD><br />
<TD align=middle>Tue</TD><br />
<TD align=middle>Wed</TD><br />
<TD align=middle>Thu</TD><br />
<TD align=middle>Fri</TD><br />
<TD align=middle>Sat</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">1</TD><br />
<TD vAlign=top width="14%">2</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">3</TD><br />
<TD vAlign=top width="14%">4</TD><br />
<TD vAlign=top width="14%">5</TD><br />
<TD vAlign=top width="14%">6</TD><br />
<TD vAlign=top width="14%">7</TD><br />
<TD vAlign=top width="14%">8</TD><br />
<TD vAlign=top width="14%">9</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 6:30pm</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">10</TD><br />
<TD vAlign=top width="14%">11</TD><br />
<TD vAlign=top width="14%">12</TD><br />
<TD vAlign=top width="14%">13</TD><br />
<TD vAlign=top width="14%">14</TD><br />
<TD vAlign=top width="14%">15</TD><br />
<TD vAlign=top width="14%">16</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">17</TD><br />
<TD vAlign=top width="14%">18</TD><br />
<TD vAlign=top width="14%">19</TD><br />
<TD vAlign=top width="14%">20</TD><br />
<TD vAlign=top width="14%">21</TD><br />
<TD vAlign=top width="14%">22</TD><br />
<TD vAlign=top width="14%">23</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 7:00pm</P></TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>Wayne away </P><br />
<P>until July 9</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">24</TD><br />
<TD vAlign=top width="14%">25</TD><br />
<TD vAlign=top width="14%">26</TD><br />
<TD vAlign=top width="14%">27</TD><br />
<TD vAlign=top width="14%">28</TD><br />
<TD vAlign=top width="14%">29</TD><br />
<TD vAlign=top width="14%">30</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 7:00pm</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR></TBODY></TABLE><br />
</BODY></html><br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/July|To July 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/Alberta/Calender/JuneAlberta/Calender/June2007-06-28T19:53:25Z<p>Vhouston: </p>
<hr />
<div><html><HEAD><TITLE>Untitled Document</TITLE><br />
<META http-equiv=Content-Type content="text/html; charset=iso-8859-1"><br />
<META content="MSHTML 6.00.2900.3086" name=GENERATOR></HEAD><br />
<BODY><br />
<TABLE height=586 cellSpacing=0 borderColorDark=#000000 cellPadding=2 <br />
width="95%" align=center border=1><br />
<TBODY><br />
<TR><br />
<TD align=middle colSpan=7 height=35><br />
<H3>June&nbsp;&nbsp;2007</H3></TD></TR><br />
<TR><br />
<TD align=middle>Sun</TD><br />
<TD align=middle>Mon</TD><br />
<TD align=middle>Tue</TD><br />
<TD align=middle>Wed</TD><br />
<TD align=middle>Thu</TD><br />
<TD align=middle>Fri</TD><br />
<TD align=middle>Sat</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">&nbsp;</TD><br />
<TD vAlign=top width="14%">1</TD><br />
<TD vAlign=top width="14%">2</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">3</TD><br />
<TD vAlign=top width="14%">4</TD><br />
<TD vAlign=top width="14%">5</TD><br />
<TD vAlign=top width="14%">6</TD><br />
<TD vAlign=top width="14%">7</TD><br />
<TD vAlign=top width="14%">8</TD><br />
<TD vAlign=top width="14%">9</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 6:30pm</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">10</TD><br />
<TD vAlign=top width="14%">11</TD><br />
<TD vAlign=top width="14%">12</TD><br />
<TD vAlign=top width="14%">13</TD><br />
<TD vAlign=top width="14%">14</TD><br />
<TD vAlign=top width="14%">15</TD><br />
<TD vAlign=top width="14%">16</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">17</TD><br />
<TD vAlign=top width="14%">18</TD><br />
<TD vAlign=top width="14%">19</TD><br />
<TD vAlign=top width="14%">20</TD><br />
<TD vAlign=top width="14%">21</TD><br />
<TD vAlign=top width="14%">22</TD><br />
<TD vAlign=top width="14%">23</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 7:00pm</P></TD><br />
<TD vAlign=top width="14%" height=65><br />
<P>Wayne away </P><br />
<P>until July 9</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%">24</TD><br />
<TD vAlign=top width="14%">25</TD><br />
<TD vAlign=top width="14%">26</TD><br />
<TD vAlign=top width="14%">27</TD><br />
<TD vAlign=top width="14%">28</TD><br />
<TD vAlign=top width="14%">29</TD><br />
<TD vAlign=top width="14%">30</TD></TR><br />
<TR><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp<br />
<P>iGEM Meeting</P><br />
<P>CSC2-49 7:00pm</P></TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD><br />
<TD vAlign=top width="14%" height=65>&nbsp;</TD></TR></TBODY></TABLE><br />
</BODY></html><br />
<br />
[[Alberta|UofA iGEM Home]]<br><br />
[[Alberta/Calender/July|To July 2007]]</div>Vhoustonhttp://2007.igem.org/wiki/index.php/File:Veronica.jpgFile:Veronica.jpg2007-06-25T22:45:04Z<p>Vhouston: </p>
<hr />
<div></div>Vhouston