From 2007.igem.org

My Construction Files
My Sequencing Files

Two Projects: Myoglobin and H-NOX

Hcole 13:32, 21 June 2007 (EDT) Since my wiki is the only one currently working out of the high schoolers I have volunteered to write up summary of our first week of training so here it goes: On our first day (6/11/07) we went over the basic oligo tutorial and the overview of cloning the Chris made ( to view these follow this link http://www.openwetware.org/wiki/Arking:JCAOligoTutorialHome ) The overview discusses cloning both verbally and pictorially, I found it very helpful in gaining a basic visual understanding of what we will be doing this summer. We worked as a group to complete the tutorial quiz on construction files and designing oligos. We also discussed how PCR works, restriction enzymes inserts etc. and how to use ApE. Next we watched some videos filmed at the undergrad training. They essentially outlined the project that our iGEM team will be working on and the different divisions of work that people would be doing. On 6/12/07 we got into the actual experimental process of cloning. As part of our training we were going to complete as a group a cloning from start to finish. Amin led us through the first process PCR. First we discussed what exactly PCR does then Amin outlined the key components of PCR template, primers, nucleotides, and enzymes. Next we went over the "recipe" of the PCR so how much of each component we needed the concentration of buffers etc. Amin also told us about the proper handling of the materials by showing us where they needed to be stored and the temperatures needed to maintain our components. We also went over the order in which the components need to be added. Our plasmid, template, and primers were given to us by Lane and they are part of his research. So once we put all the components in the tubes we put them in the PCR machine for 2 hours. We went to lunch and then came back to clean our PCR product. We used a DNA recovery kit. The entire process involves adding solution from the kit centrifuging 3 times, ( 2 wet IE with water, and once dry) elution with water, and centrifuging it to "catch" the DNA. The next day ( 6/13/07) was a busy day. We started by digesting our insert and plasmid in the restriction enzymes BglII and XhoI once again we learned the proper volumes of each component of digestion to use once we'd made our solution we incubated it. About 2 hours later we got out our digests and added them to an agarose gel Image:gel1.jpg . We later extracted them from the gel after locating them on the gel. We had to melt our extracted DNA because it was still in gel form. After the gel had melted we began the ligation process when we join our insert and plasmid together. After ligation we checked our ligation product on a gel to see if it had the right number of bp (base pairs). Next we had to get our plasmid containing our gene into E. Coli. To get the product through the membrane we heated up the bacteria with the plasmid/insert allowing the plasmid/insert to enter the bacteria. Then we cooled them to make sure the bacterias membrane was no longer penetrable. Then we let them grow on a plate overnight. When we came back on 6/14/07 we had colonies. Next we performed a colony PCR to see if out insert was actually in the bacteria. After placing our PCR product in a gel we discovered that our bacteria might have the insert since the PCR product had the right number of bp. We wanted to send our plasmid/insert in for sequencing so we grew our bacteria in a liquid medium overnight. On 6/15/07 we took our liquid grown bacteria and started mini prep so we could send it in for sequencing. In order to do this we had to remove our plasmid from the bacteria we had to lice them or break the membrane which is essentially what mini prep does. Placed primers on our plasmid that would show the people sequencing it what point to start from and what direction to go. On 6/18/07 we got our sequences back. It took a loooooooooooooooooooong time to sequence check the sequences mostly because our primers were poorly designed which cause a lot of mutations in our final product. Sadly none of the mutations were silent so we did not get the product we wanted. We spent just over half our day trying to sequence our inserts. That afternoon we got started on the Single Internal Restriction Sites tutorial (you can find it in the link I gave you). We sent in our construction files for that to Chris. We also did the oligo tutorial again but this time individually. On 6/20/07 we went over any mistakes we had made in the tutorials. This essentially concluded our training. We did more stuff on 6/20/07 but I'll explain that in my next entry.

Hcole 14:48, 21 June 2007 (EDT)

On to the second half of 6/20/07! We finally got the genes we'll be focusing for the next week or however long it takes us to complete cloning. I will be working with H-NOX. For more info on H-NOX and what it does check out these research papers http://www.jbc.org/cgi/content/full/282/2/897 http://www.chemistry.ucsc.edu/teaching/Chem200A/Fall06/PaperLIst_files/MarlettaNO.pdf The sequence for H-NOX looks like this ATGAAGGGGACAATCGTCGGGACATGGATAAAGACCCTGAGGGACCTTTACGGGAATGATGTGGTTGATGAATCTTTAAAAAGTGTGGGTTGGGAACCAGATAGGGTAAT
TACACCTCTGGAGGATATTGATGACGATGAGGTTAGGAGAATTTTTGCTAAGGTGAGTGAAAAAACTGGTAAAAATGTCAACGAAATATGGAGAGAGGTAGGAAGG
CAGAACATAAAAACTTTCAGCGAATGGTTTCCCTCCTATTTTGCAGGGAGAAGGCTAGTGAATTTTTTAATGATGATGGATGAGGTACACCTACAGCTTACCAAGA
TGATAAAAGGAGCCACTCCTCCAAGGCTTATTGCAAAGCCTGTTGCAAAAGATGCCATTGAAATGGAGTACGTTTCTAAAAGAAAGATGTACGATTACTTTTTAGG
GCTTATAGAGGGTAGTTCTAAATTTTTCAAGGAAGAAATTTCAGTGGAAGAGGTCGAAAGAGGCGAAAAAGATGGCTTTTCAAGGCTAAAAGTCAGGATAAAATTT
AAAAACCCCGTTTTTGAGTATAAGAAAAATTAA
I had to make primers so we could order them that afternoon. I decided to cut with BglII and XhoI so my primers look like this Forward:ctagtAGATCTATGAAGGGGACAATCGTCGG Reverse: cgtgaCTCGAGgaatgGGATCCTTAATTTTTCTTATACTCA The plasmid I will be using will be pBca9145-Bca1144 which looks like this :Image:pcatext.txt I will be cutting with BglII and XhoI as I mentioned before. The insert and primers looks like this: Image:hnoxp.txt The plasmid+insert should look something like this: Image:insplas.txt. Here is my construction file Image:conhnox.txt

Hcole 23:31, 23 June 2007 (EDT)

The lab flooded 6/22/07 so I'm taking this opportunity to update the stuff from 6/21/07. On 6/21/07 I got the template for H-NOX so we started PCR. The template was titled Tt29nglal ( this is what I think it said the writing was really small) First I had to dilute my primer since it was in powder form so I made a solution fo 1mM primer and 9mM water to make a 10X solution. For PCR I used 36mL water (mL = microliters) 10mL buffer I think it was called Phusion I'll have to double check. I mL forward primer 1mL reverse primer 1mL 10 millimolar dNTP's .5mL template .5mL enzyme. I the put it in the centrifuge for a quick mix and then in the PCR machine on the PCR 3 step template setting.

Hcole 17:46, 25 June 2007 (EDT)

Back in the lab today. I got mixed up on the order in which to continue after my PCR. I accidentally did PCR clean up before putting it in a gel. I used the Zymoclean Gel DNA recovery kit. I used 200mL of ADB buffer and my entire PCR product. I centrifuged it for 15 seconds dumped it then repeated this twice but instead of adding PCR product and ADB buffer I just added wash buffer to the column. Then I dry centrifuged it for 90 seconds then I accidentally added 200mL of water when I should have used 90mL causing my PCR to be diluted. I centrifuged after adding water for 90 seconds. Then I put it in a gel. I used 15mL of PCR product and 1.5mL of 10X loading buffer I also put 8mL of marker in a seperate well. This gel didn't really work so I did another one using 20mL of PCR 2mL loading buffer and 8mL marker. This one worked much better! Image:P0000484.jpg . My PCR product came out around 500-700bp which is what I wanted. After gel testing it I set up for digestion. I used 30mL PCR product 1mL of BglII and 1mL of XhoI and 1mL of DPNI 10mL of buffer number 2 and 57mL of H2O for a total volume of 100mL. I placed it in the 37 degree incubator and should be taking it out in about 15 minutes which would equal a total incubation time of 90 minutes.

Hcole 19:21, 25 June 2007 (EDT)

I did digestion clean up after letting my digestion incubate for 90 minutes. I used 200mL ADB buffer centrifuged for 15 seconds. Used DNA Wash Buffer twice at 15 seconds and dry for 90 seconds. I changed columns and added 10mL H20 and centrifuged for 90 seconds. Then I pipeted it into a smaller tube and began to set up my ligation. I used 4.5mL H20 , 3mL of my PCR product (insert), 1mL of pre-digested and gel extracted 9145 template ( thanks Austin!), 1mL 10X T4 DNA buffer, and .5mL T4 DNA Ligase. I mixed it all together and will be letting it sit 45 minutes or so before transformation. For transformation I added 200mL H20 and 30mL 5X KCM to my competent cells. Then I took 100mL of the cell mix and added it to my ligaton product. Then I put this on ice for 10 minutes heat shocked in water for 90 seconds and iced for 90 seconds. Then I plated it on an Amp plate overnight.

Hcole 11:21, 27 June 2007 (EDT)

I came and checked my plate yesterday and I had colonies so I put the pipettes with bacteria selected from my colonies in LB broth with carb and put them in the 37 degree shaker overnight. Then Chris gave me a vector with myoglobin in it. Chris doesn't know exactly where the myoglobin is but he wants me to find out and make a biobrick out of it. The vector is called PBond Vector W6 APS-Myoglobin His6-tct and we don't have a sequences for it. I took 1mL of the vector and added it to competent cells ( exact volume unknown) along with 50mL H20 and 30mL 5X KCM. I then put it in the 37 degree shaker for about 45 minutes and then I cooled it for 10 mins in ice then I heat shocked it for 90 seconds and cooled it for 90 seconds. Then I plated it on a tct plate. I'm slightly worried that the colonies wont turn out ok because there are so many competent cells and not as much vector.

Hcole 15:40, 27 June 2007 (EDT) All of this morning has been spent doing miniprep on my three plate samples. I followed the guidelines for miniprep posted on the lab wall most of which come from the pamphlet contained in the Qiagen kit http://www1.qiagen.com/literature/handbooks/literature.aspx?id=1000248 I used the microcentrifuge method. After miniprep I began a diagnostic digestion of the plasmid contained in my bacteria. I use 3mL of plasmid, 1mL of NEB 2 buffer, .5 mL of XhoI, .5mL of BglII, and 5 mL of H20 for a total volume of 10mL. I checked my other plate with my Myoglobin vector and I have colonies this afternoon I will grow them in liquid medium.

Hcole 20:37, 27 June 2007 (EDT)

I accidentally cleaned my diagnostic digest when I wasn't supposed. It's ok though I might have lost some DNA but it's still there. I cut all the volumes for clean up by ten so the volume was a lot smaller. I ran it on a gel using 5mL of my digested plasmid and 1mL 5X loading gel. Unfortunately my ladder was pretty much noexistent see picture: Image:badgel.jpg . There are two distinct bands though so I'm sending it in for sequencing about 8mL of each. After this I took some bacteria from my myoglobin plate and added it to 2000mL LB and 2mL Tet 1000X. Then I put it in the 37 degree shaker. An hour later I took it out of the shaker. I took 1000mL and added 1mL of arabinose to one. Then I put both of them back in the shaker they'll stay there overnight.

Hcole 13:28, 28 June 2007 (EDT) My email to Quintara didn't go through so I had to prepare my samples for sequencing again. The volume for my myoglobin bacteria was too low so I remade it with 10 mililiters LB and 5 microliters Tet. I put it in the shaker for over an hour. Then I took it out the shaker and put 5 mililiters in another tube. To this other tube I added 5 microliters Arabinose and 5 microliters Iron Sulfide FeSO4 and placed both tubes back in the shaker to sit overnight. Amin told us the basics about composite parts and operons and that concluded the day.

Hcole 14:06, 29 June 2007 (EDT)

I came in and checked my email and got my sequences from Quintara. I'm really happy with how they came out. H1 and H2 both had my insert but were missing the EcoRI site. The third had all the sites. All three didn't match up after my insert but Amin said that it's normal for that to happen since sequence quality isn't good till you get about 50 or so bp in. I spent most of this morning formatting my wiki especially the sequencing section. Then after lunch I miniprepped my Myoglobin vector and added 2nL 5X Ca056 primer to 8nL of my vector. I used the one without arabinose and Fe. Then I sent it in for sequencing which I should be analyzing if all goes well on Monday. Then after a lengthy talk about what to do for our transformations I put my H3 sample which had the best sequencing result on a plate to grow in lefty strain bacteria with 5X KCM on a Cam/Carb plate. Vinni will be growing up the same promoter RBS and terminator that I will need so John told him to make the plates for those since he'd already started.

Hcole 15:44, 2 July 2007 (EDT)

So I came in this morning and looked at my plate. It's not really the best result. I have tons of bacteria so much that it will be hard to pick one single bacteria. There was also some contamination on my plate though no one is really sure how this got there since I plated everything in a sterile environment. I'm pretty sure I'll be able to grow some up in liquid culture though. Then I checked my Myoglobin sequence that I got back from Quintara. Amin showed me how to search for nucleotide sequences within my plasmid on BLAST. We got a 99% match for Sperm Whale Myoglobin. We were able to find it within my sequencing results but it has 3 internal restriction sites. It's not going to be pretty and it's definately going to be hard. I designed my primers which I will post up here once they've been checked by Amin or Farnaz. After lunch I took two bacteria from my H-NOX sample 3 plate and put them in liquid culture to grow in the incubator overnight.

Hcole 18:04, 2 July 2007 (EDT)

New plan of attack for my Myoglobin. We're going to get it synthesized as well as have me work on it but only remove 2 of the internal restriction sites. I'll be removing BglII and XhoI since I will be cutting with them and I will leave EcoRI in the insert. My primers look like this : Outside Forward cgttaAGATCTATGGTTCTGTCTGAAGGTGAATGG. Outside Reverse: ggtcatCTCGAGgttacGGATCCTCATCCCGAGCCACCCTGGTAACCC BglII Forward: GAAAGCTTCTGAAGACCTGAAAAAACATGGTGTTAC BglII Reverse: GTAACACCATGTTTTTTCAGGTCTTCAGAAGCTTTC XhoI Forward:GCTATGAACAAAGCTCTAGAGCTGTTCCGTAAAGA and XhoI Reverse: TCTTTACGGAACAGCTCTAGAGCTTTGTTCATAGC

Hcole 18:39, 3 July 2007 (EDT)

I minipreped my H-NOX sample 3 bacteria this morning. Then I did a test digest using EcoRI and XhoI. Then I ran this on a gel to make sure it was my plasmid and not contamination. I got a very faint band on one of them. Here is a picture of the gel Image:tdh.jpg