From 2007.igem.org

Construction of Cre biobrick with weaker start codon

PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)

PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716213 (TTG start)

---

sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc