USTC/HybridOperator

From 2007.igem.org

< USTC(Difference between revisions)

Latest revision as of 06:43, 27 October 2007

As we mentioned in Operator Composition, biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).

Hybrid Operators for Heterodimeric Repressor

Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be strong. Now it is clear that asymmetric O24 can be bound to both by R2 and R4, but neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa. We can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.

Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.

Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.

Hybrid Operators for Weaker Binding

There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [1]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page Operator Composition.)

References

1. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.

@@ Line 1: / Line 1: @@
-Biologists always use symmetric LacI-family operators, e.g. AATTGTGAAC GTTCACAATT (O44) and AATTGTAAGC GCTTACAATT (O22). Please notice that they are all 20bp long and each right 10bp-long strand’s complementary strand is reversed symmetric with its left 10bp-long strand. For short we call this kinds of symmetrical operators as Oxx, for example, O44, O22, etc. Then you must have already understood what O24 means-- Yes, it means the asymmetric operator AATTGTAAGC GTTCACAATT (O24), which has the left 10bp-long strand of O22 and the right 10bp-long one of O44. Again for example, O42 means AATTGTGAAC GCTTACAATT (O42), and so on. We also give these asymmetric operators another name: Hybrid Operators.
+[[USTC/NamingRules|Naming Rules for Oxx and Oxy below]]
-Biologists always use symmetric operators like O22 because they are the most suitable ones to be bound by their own specific repressor(s). If we call the highly specified repressor protein which can bind well on O44 as R4 and the one on O22 as R2, well then it is clearly that asymmetric O24 can be bind by both R2 and R4, but they are all not very suitable because R4 is specific for O44 instead of O22 and vice versa. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two self-same monomers, so one side of R2 can bind to O24’s left-half strand while the other side would not bring about any remarkable effect on the right. To bind to half strand could still maintain repression, but distinctly it could no longer be that strong. Now we can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.
+As we mentioned in [[USTC/OperatorComposition|'''Operator Composition''']], biologists always use symmetric operators like O22 because they are the most suitable ones to be bound to by their own specific repressor(s).
+==Hybrid Operators for Heterodimeric Repressor==
+Assumed that R4 is the highly specific repressor protein that well binds to O44, and so does R2 to O22. Luckily these LacI-family Repressors are also symmetric, each of them is combined by two same monomers, so one side of R2 can bind to O24's left-half strand while the other side would not bring about any remarkable effect on the right. To bind on half strand could still maintain repression, but distinctly it could no longer be strong. Now it is clear that asymmetric O24 can be bound to both by R2 and R4, but neither of them is very suitable because R4 is highly specific only for O44 rather than O22, and vice versa.  We can say that hybrid operator O24 is a “weaker” operator for R2 or R4 because their weaker binding compared with R2+O22 or R4+O44.
-There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it.[参考文献] It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to substitute O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound by R4 for our purpose. (Get more details about Ox6 and Ox7 on page [[USTC/Further_More|Further More]].)
+Furthermore, the dimerization regions of our artificial repressors are uniform, so they can combine into the heterodimeric form, for example, heterodimer R2~R4. Its one side of R2 can bind to O24's left-half strand specifically while the other side of R4 binds on the right half as well. On the whole, heterodimer R2~R4 can bind on O24 as tightly as R2+O22 or R4+O44.
+[[Image:USTC_HybridOperator.png|500px|thumb|center|Supposed mechanism of hybrid operator. It appears as a weak operator to homodimers, and only heterodimers can bind to it tightly.]]
+==Hybrid Operators for Weaker Binding==
+There is another kind of “weaker” operators Ox6, for example, AATTGTGAAC GCTCATAATT (O46). The symmetric prototype AATTATGAGC GCTCATAATT (O66) is an interesting operator, because all the known LacI-family repressors would not have detectable repression on it [[USTC/HybridOperator#References|[1]]]. It is obvious that O46 is a “weaker” operator only to R4 (compared with R4+O44), but not a valid operator to other repressors that are not specific for O44. On the other hand, O24 is a “weaker” operator to both R4 and R2. We also try to use random sequence GACGACTGTA TACAGTCGTC (O77) to replace O66, that is to say, O47 is sequence AATTGTGAAC TACAGTCGTC. It seems that O47 might behave just like O46, but actually it is too weak to be bound to by R4 for our purpose. (Comparable data of Ox6 and Ox7 on page [[USTC/OperatorComposition|Operator Composition]].)
-----
-    O11 aattgtgagcgctcacaatt
-    O22 aattgtaagcgcttacaatt
-    O33 aattgtaaacgtttacaatt
-    O44 aattgtgaacgttcacaatt
-    O55 aattttgagcgctcaaaatt
-    O66 aattatgagcgctcataatt
-    O77 gacgactgtatacagtcgtc
+== References ==
-<br>
+. Sartorius, J.; Lehming, N.; Kisters, B.; von Wilcken-Bergmann, B. & Müller-Hill, B. (1989), lac repressor mutants with double or triple exchanges in the recognition helix bind specifically to lac operator variants with multiple exchanges., EMBO J 8(4), 1265--1270.
-<br>