OtsA-construction file
From 2007.igem.org
(Difference between revisions)
Line 1: | Line 1: | ||
- | PCR | + | PCR ThpA F/R on ThpA (553bp, BglII/XhoI)<br> |
- | + | Sub into PBca1144 (BglII/XhoI, 2054+910 L)<br> | |
- | -------------------------------------------- | + | Product is pBca9145-BBa I716331 <br> |
- | + | ---------------------------------------------------------------------------------------------<br> | |
- | + | ThpAF Forward BglII site anneals to ThpA cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg<br> | |
- | + | <br> | |
- | -------------------------------------------- | + | |
- | + | ThpAR Reverse XhoI site anneals to ThpA anneals to XhoI cgcatctcgagtcaggtggcgaacgggccta | |
- | + | ||
- | + | ||
- | + |
Revision as of 17:49, 2 July 2007
PCR ThpA F/R on ThpA (553bp, BglII/XhoI)
Sub into PBca1144 (BglII/XhoI, 2054+910 L)
Product is pBca9145-BBa I716331
ThpAF Forward BglII site anneals to ThpA cgtacAGATCTatgaccgccgcaccagcagattttgcccgtgcccgaagcgaGttcctcagtatcg
ThpAR Reverse XhoI site anneals to ThpA anneals to XhoI cgcatctcgagtcaggtggcgaacgggccta