From 2007.igem.org

Revision as of 06:30, 19 July 2007

Preliminaries

1. Usefull links (restriction enzymes)(Software)<open wetware primer design> <more primer design>
2. Sequences:
   1. Ncbi genebank AF053765 (pNL26 7371bp) (pNL29 6036bp) [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] (FASTA seq.)
   2. pBluescriptIIKS+ [http://www.stratagene.com/products/displayProduct.aspx?pid=267 (stratagene) ][http://www.stratagene.com/vectors/sequences/pbl2ksp_s.txt (sequence) ] [http://www.stratagene.com/vectors/restriction_sites/pbl2ksp_r.txt (restriction map) ][http://www.stratagene.com/vectors/maps/pdf/pBluescript%20II%20KS+_%20webpg.pdf (map) ] [http://www.stratagene.com/manuals/212205.pdf (Manual)]
      • (no spaces sequence 2961bp)
      • HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701 ,Xbal cuts at 677 ,SpeI cuts at 683
      • (no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)
   3. pNL26 Plasmid with insert: (seq 10318bp) (res map) (digests) (reverse complement)
      1. pNL26 insert PstI--HindIII:(pNL26 7371bp)
   4. pNL29 Plasmid with insert: (seq 8983bp) (res map) (digests) (reverse complement)
      1. pNL29 insert PstI--HindIII:(pNL29 6036bp)
   5. Frame arrangement for Biobrick protein expression.
   6. Biobrick expression plasmid system.
   7. Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations
      1. design primers
      2. create registery parts
   8. pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators.
   9. pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU
      1. design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required.
      2. create registery parts
3. Other investigations
   1. Locate putative transcription terminators.
   2. Locate putative ribosome binding sites.
   3. Locate putative regulation sequences/ promotors.
   4. Confirm putative genes.
   5. Blast search homology of each putative ORF & gene.
   6. Produce phylogenic maps of Gvps.

Steps:

1. Recovery of genes: (2 days)
   1. Recover the plasmid from paper provided into solution.(method)
   2. Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock)
   3. pick 3 colonies of each
   4. Overnight Culture x9(6 above and 3 form agar block provided)
   5. Miniprep
   6. Produce glycerol stocks
   7. Confirm presence in recovered sample using digest.(HindIII)
   8. ->Established Supply of Plasmid
2. Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days)
   1. Confirm transcription RT-PRC,
   2. Confirm translation (buoyant phenotype method).
   3. Confirm translation (Namarski optics (direct interferance contrast microscopy method).
3. Removal of four biobrick like restriction sites all in GvpL.
   1. DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon (result)
   2. (Quickchange XL Kit)[http://www.stratagene.com/sdmdesigner/default.aspx (Primer design program) ] [http://www.stratagene.com/downloads/qc/200521.pdf (Manual)](Primer program output)
   3. EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)]
      • Replace with [GA A][AAT][TC A] Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%).
   4. PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)]
      • Replace with [CTG][CAA] Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
   5. XbaI [TCTAGA] (not present)
   6. SpeI [ACTAGT] (not present)
4. Insertion of biobrick required restriction sites by PCR primer modification.(method)
   1. Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
      1. PREFIX Primer 3cctttctagag5 11 bp adds XbaI
      2. SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I)
      3. In Frame for expression when combined with Lac promotor.
   2. Primer generation
   3. Plasmid extraction from culture
   4. PCR
   5. Restriction EcoR1 & Spe1
   6. Gel separation
   7. Restriction of standard Library death plasmid EcoR1,Spe1.
   8. Ligation.
   9. Transform host with regulated POPS output
   10. Confirm dna, rna , protein (as for A)

supplementary material for use in experiments

• pNL26 parts:
  • GvpA (DNA sequence) (protein sequence)
    • EcoRI restriction site 7089 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
    • coden pair change:
    • Primer

• • GvpP (DNA sequence) (protein sequence)
    • PstI restriction site 6389 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
    • coden pair change:
    • mutation Primer
  • GvpQ (DNA sequence) (protein sequence)
    • PstI two restriction sites 6136 & 6169 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)]
    • coden pair change:
    • mutation Primer #1
    • mutation primer #2
  • ORF1 (DNA sequence) (protein sequence)