BerkiGEM2007-SamanthaConstructionFile7
From 2007.igem.org
(Difference between revisions)
| (2 intermediate revisions not shown) | |||
| Line 1: | Line 1: | ||
| - | Construction of Cre biobrick with weaker start codon | + | '''Construction of Cre biobrick with weaker start codon''' |
| + | |||
| + | |||
| + | |||
| + | PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | ||
| + | Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | ||
| + | Product is pBca9145-I716212 (GTG start)<br> | ||
| + | |||
| + | |||
| + | PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | ||
| + | Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | ||
| + | Product is pBca9145-I716213 (TTG start)<br> | ||
| + | ---------------------------- | ||
| + | sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac<br> | ||
| + | sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac<br> | ||
| + | G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc | ||
Latest revision as of 22:56, 5 June 2007
Construction of Cre biobrick with weaker start codon
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)
PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716213 (TTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc
