BerkiGEM2007-SamanthaConstructionFile7
From 2007.igem.org
(Difference between revisions)
| Line 8: | Line 8: | ||
| - | PCR | + | PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> |
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | ||
Product is pBca9145-I716213 (TTG start)<br> | Product is pBca9145-I716213 (TTG start)<br> | ||
Latest revision as of 22:56, 5 June 2007
Construction of Cre biobrick with weaker start codon
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)
PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716213 (TTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc
