BerkiGEM2007-SamanthaConstructionFile7
From 2007.igem.org
(Difference between revisions)
| Line 5: | Line 5: | ||
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | ||
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | ||
| - | Product is pBca9145- | + | Product is pBca9145-I716212 (GTG start)<br> |
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp) <br> | ||
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L) <br> | ||
| - | Product is pBca9145- | + | Product is pBca9145-I716213 (TTG start)<br> |
---------------------------- | ---------------------------- | ||
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac<br> | sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac<br> | ||
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac<br> | sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac<br> | ||
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc | G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc | ||
Revision as of 18:23, 5 June 2007
Construction of Cre biobrick with weaker start codon
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716213 (TTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc
