BerkiGEM2007-SamanthaConstructionFile7

From 2007.igem.org

Revision as of 22:56, 5 June 2007 by Samanthaliang (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)

Construction of Cre biobrick with weaker start codon


PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (GTG start)


PCR sil06 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716213 (TTG start)


sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc