BerkiGEM2007-SamanthaConstructionFile7
From 2007.igem.org
Revision as of 17:45, 5 June 2007 by Samanthaliang (Talk | contribs)
Construction of Cre biobrick with weaker start codon
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716211 (GTG start)
PCR sil05 and G00101 on pBca9145-Bca1117 (PCR product is 1147bp, BglII/XhoI 1047 bp)
Sub into pBca9145-Bca1089 (BglII/XhoI, 2063+696, L)
Product is pBca9145-I716212 (TTG start)
sil05 Forward BglII Cre with GTG start ctagcAGATCTgtgtccaatttactgaccgtac
sil06 Forward BglII Cre with TTG start ctagcAGATCTttgtccaatttactgaccgtac
G00101 Reverse Sequencing of pSB1A* plasmids attaccgcctttgagtgagc
