Melb:Plan:Blue Photosensor
From 2007.igem.org
(Difference between revisions)
Line 1: | Line 1: | ||
- | Steps: | + | =Preliminaries= |
+ | # Usefull links [[Melbourne/primary Restriction enzymes|(restriction enzymes)]][[Melbourne/Software|(Software)]][[http://www.openwetware.org/wiki/Designing_primers|<open wetware primer design>]] [[http://www.mcb.uct.ac.za/pcroptim.htm|<more primer design>]] | ||
+ | # Sequences: | ||
+ | ## Ncbi genebank AF053765 [[Melbourne/AF053765-pNL26|(pNL26 7371bp)]] [[Melbourne/AF053765-pNL29|(pNL29 6036bp)]] [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] [[Melbourne/AF053765FASTA| (FASTA seq.)]] | ||
+ | ## pBluescriptIIKS+ [http://www.stratagene.com/products/displayProduct.aspx?pid=267 (stratagene) ][http://www.stratagene.com/vectors/sequences/pbl2ksp_s.txt (sequence) ] [http://www.stratagene.com/vectors/restriction_sites/pbl2ksp_r.txt (restriction map) ][http://www.stratagene.com/vectors/maps/pdf/pBluescript%20II%20KS+_%20webpg.pdf (map) ] [http://www.stratagene.com/manuals/212205.pdf (Manual)] | ||
+ | ##*[[Melbourne/pBluescriptIIKS nospaces|(no spaces sequence 2961bp)]] | ||
+ | ##*HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701 ,Xbal cuts at 677 ,SpeI cuts at 683 | ||
+ | ##*[[Melbourne/pBluescriptIIKS PstI HindIII |(no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)]] | ||
+ | ## pNL26 Plasmid with insert:[[Melbourne/cannon plasmid pNL26 seq| (seq 10318bp)]] [[Melbourne/cannon plasmid pNL26 res map| (res map)]] [[Melbourne/cannon plasmid pNL26 HindIII digest|(digests)]] [[Melbourne cannon plasmid pNL26 rev compl seq|(reverse complement)]] | ||
+ | ### pNL26 insert PstI--HindIII:[[Melbourne/AF053765-pNL26|(pNL26 7371bp)]] | ||
+ | ## pNL29 Plasmid with insert:[[Melbourne/cannon plasmid pNL29 seq| (seq 8983bp)]] [[Melbourne/cannon plasmid pNL29 res map| (res map)]] [[Melbourne/cannon plasmid pNL29 HindIII digest| (digests)]] [[Melbourne cannon plasmid pNL29 rev compl seq|(reverse complement)]] | ||
+ | ### pNL29 insert PstI--HindIII:[[Melbourne/AF053765-pNL29|(pNL29 6036bp)]] | ||
+ | ##Frame arrangement for Biobrick protein expression. | ||
+ | ##Biobrick expression plasmid system. | ||
+ | ##Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations | ||
+ | ###design primers | ||
+ | ###create registery parts | ||
+ | ##pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators. | ||
+ | ##pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU | ||
+ | ###design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required. | ||
+ | ###create registery parts | ||
+ | #Other investigations | ||
+ | ## Locate putative transcription terminators. | ||
+ | ## Locate putative ribosome binding sites. | ||
+ | ## Locate putative regulation sequences/ promotors. | ||
+ | ## Confirm putative genes. | ||
+ | ## Blast search homology of each putative ORF & gene. | ||
+ | ## Produce phylogenic maps of Gvps. | ||
+ | ==Steps:== | ||
+ | # Recovery of genes: (2 days) | ||
+ | ## Recover the plasmid from paper provided into solution.(method) | ||
+ | ## Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock) | ||
+ | ## pick 3 colonies of each | ||
+ | ## Overnight Culture x9(6 above and 3 form agar block provided) | ||
+ | ## Miniprep | ||
+ | ## Produce glycerol stocks | ||
+ | ## Confirm presence in recovered sample using digest.(HindIII) | ||
+ | ## ->Established Supply of Plasmid | ||
+ | # Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days) | ||
+ | ## Confirm transcription RT-PRC, | ||
+ | ## Confirm translation (buoyant phenotype method). | ||
+ | ## Confirm translation (Namarski optics (direct interferance contrast microscopy method). | ||
+ | # Removal of four biobrick like restriction sites all in GvpL. | ||
+ | ## DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon [[Melbourne/Ecoli K12 usage|(result)]] | ||
+ | ## [[Melbourne QuickchangeXL|(Quickchange XL Kit)]][http://www.stratagene.com/sdmdesigner/default.aspx (Primer design program) ] [http://www.stratagene.com/downloads/qc/200521.pdf (Manual)][[Melbourne/GvpL site dirrected primers|(Primer program output)]] [[Melbourne/Gvp site dirrected primers|(hand designed primers ordered)]] | ||
+ | ## EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)] | ||
+ | ##* Replace with [GA A][AAT][TC A] Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%). | ||
+ | ## PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)] | ||
+ | ##* Replace with [CTG][CAA] Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%). | ||
+ | ## XbaI [TCTAGA] (not present) | ||
+ | ## SpeI [ACTAGT] (not present) | ||
+ | # Insertion of biobrick required restriction sites by PCR primer modification.(method) | ||
+ | ## Design of primers: see: http://www.openwetware.org/wiki/Designing_primers | ||
+ | ###PREFIX Primer 3cctttctagag5 11 bp adds XbaI | ||
+ | ###SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I) | ||
+ | ###In Frame for expression when combined with Lac promotor. | ||
+ | ## Primer generation | ||
+ | ## Plasmid extraction from culture | ||
+ | ## PCR | ||
+ | ## Restriction EcoR1 & Spe1 | ||
+ | ## Gel separation | ||
+ | ## Restriction of standard Library death plasmid EcoR1,Spe1. | ||
+ | ## Ligation. | ||
+ | ## Transform host with regulated POPS output | ||
+ | ## Confirm dna, rna , protein (as for A) | ||
+ | ==supplementary material for use in experiments== | ||
+ | *pNL26 parts: | ||
+ | **GvpA [[melbourne/GvpA DNA sequence|(DNA sequence)]] [[Melbourne/GvpA protein sequence| (protein sequence)]] | ||
+ | ***EcoRI restriction site 7089 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] | ||
+ | ***coden pair change: Isoleucine T57C: [ATT](K12 usage 30%) to [ATC](K12 usage 25%).(adds EcoRV) | ||
+ | ***Primer T57AF 5'-ttagcagaagtgattgatcgaatcctcgacaaagggattg-3' | ||
+ | ***Primer T57AR 5'-caatccctttgtcgaggattcgatcaatcacttctgctaa-3' | ||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | |||
- | + | **GvpP [[melbourne/GvpP DNA sequence|(DNA sequence)]] [[Melbourne/GvpP protein sequence| (protein sequence)]] | |
- | + | ***PstI restriction site 6389 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] | |
- | + | ***coden pair change:Glutamine G441A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%). | |
- | + | ***mutation Primer G441AF 5'-aatatgaacgaccagctgcaacgcattgaagagatg-3' | |
- | + | ***mutation Primer G441AR 5'-catctcttcaatgcgttgcagctggtcgttcatatt-3' | |
- | + | **GvpQ [[melbourne/GvpQ DNA sequence|(DNA sequence)]] [[Melbourne/GvpQ protein sequence| (protein sequence)]] | |
- | + | ***PstI two restriction sites 6136 & 6169 of [http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=3089519| (original source)] | |
- | + | ***coden pair change:Glutamine G150A,G183A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%). | |
- | + | ***mutation Primer #1 G150AF: 5'-aaaactgaagggaaactgcaagaaaaagcaaatgaagcgtc-3' | |
- | + | ***mutation Primer #1 G150AR: 5'-gacgcttcatttgctttttcttgcagtttcccttcagtttt-3' | |
- | + | ***mutation Primer #1 G183AF: 5'-atgaagcgtcagaaaaactgcaagaaacaaaagaaaaaaatgccc-3' | |
- | + | ***mutation Primer #1 G183AR: 5'-gggcatttttttcttttgtttcttgcagtttttctgacgcttcat-3' | |
- | + | ||
- | + | ***mutation primer #2 | |
- | + | **ORF1 [[melbourne/ORF1 DNA sequence|(DNA sequence)]] [[Melbourne/ORF1 protein sequence| (protein sequence)]] | |
- | + |
Revision as of 08:59, 31 July 2007
Preliminaries
- Usefull links (restriction enzymes)(Software)[<open wetware primer design>] [<more primer design>]
- Sequences:
- Ncbi genebank AF053765 (pNL26 7371bp) (pNL29 6036bp) (original source) (FASTA seq.)
- pBluescriptIIKS+ (stratagene) (sequence) (restriction map) (map) (Manual)
- (no spaces sequence 2961bp)
- HindIII cuts at 719 ,EcoRI cuts at 707 ,PstI cuts at 701 ,Xbal cuts at 677 ,SpeI cuts at 683
- (no spaces sequence HindIII *AGCTT....CTGCA* PSTI 2947bp)
- pNL26 Plasmid with insert: (seq 10318bp) (res map) (digests) (reverse complement)
- pNL26 insert PstI--HindIII:(pNL26 7371bp)
- pNL29 Plasmid with insert: (seq 8983bp) (res map) (digests) (reverse complement)
- pNL29 insert PstI--HindIII:(pNL29 6036bp)
- Frame arrangement for Biobrick protein expression.
- Biobrick expression plasmid system.
- Basic biobrick primers pNL26F,pNL29F,pNLR, GvpAF, GvpBF, GvpUR -> 6 combinations
- design primers
- create registery parts
- pNL26 only genes biobrick pcr primers: GvpA,GvpP,GvpQ -> 6 protein generators.
- pNL29 biobrick primers: GvpB,gvpR,GvpN,GvpF,GvpG,GvpL,GvpS,GvpK,gvpJ,GvpT,GvpU
- design forward and reverse primers for each except gvpUF, GvpBR which will definately not be required.
- create registery parts
- Other investigations
- Locate putative transcription terminators.
- Locate putative ribosome binding sites.
- Locate putative regulation sequences/ promotors.
- Confirm putative genes.
- Blast search homology of each putative ORF & gene.
- Produce phylogenic maps of Gvps.
Steps:
- Recovery of genes: (2 days)
- Recover the plasmid from paper provided into solution.(method)
- Transform E.Coli strain DH5alpha. Screen with Amp 100ug/ml (as per ref.)(electroporation & heatshock)
- pick 3 colonies of each
- Overnight Culture x9(6 above and 3 form agar block provided)
- Miniprep
- Produce glycerol stocks
- Confirm presence in recovered sample using digest.(HindIII)
- ->Established Supply of Plasmid
- Induce translation overnight 37deg with IPTG in 100ml plates (method)(2days)
- Confirm transcription RT-PRC,
- Confirm translation (buoyant phenotype method).
- Confirm translation (Namarski optics (direct interferance contrast microscopy method).
- Removal of four biobrick like restriction sites all in GvpL.
- DNA code Usage in Ecoli K12 from http://www.kazusa.or.jp/codon (result)
- (Quickchange XL Kit)(Primer design program) (Manual)(Primer program output) (hand designed primers ordered)
- EcoRI [GAATTC] in gvpL (2858)is out of frame [GA G][AAT][TC A]-> [E(glutamate),N(asparagine),S(serine)]
- Replace with [GA A][AAT][TC A] Glutamate: from [GAG](K12 usage 18%) to [GAA](K12 usage 40%).
- PstI [CTGCAG] in gvpL x 3 (2522,2900,3005) each is in frame [CTG][CAG]-> [L(leucine),Q(glutamine)]
- Replace with [CTG][CAA] Glutamine: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- XbaI [TCTAGA] (not present)
- SpeI [ACTAGT] (not present)
- Insertion of biobrick required restriction sites by PCR primer modification.(method)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
- PREFIX Primer 3cctttctagag5 11 bp adds XbaI
- SUFFIX Primer 3tactagtagcggccgctgcagcctt5 25 bp adds (Spe I-Not I-Pst I)
- In Frame for expression when combined with Lac promotor.
- Primer generation
- Plasmid extraction from culture
- PCR
- Restriction EcoR1 & Spe1
- Gel separation
- Restriction of standard Library death plasmid EcoR1,Spe1.
- Ligation.
- Transform host with regulated POPS output
- Confirm dna, rna , protein (as for A)
- Design of primers: see: http://www.openwetware.org/wiki/Designing_primers
supplementary material for use in experiments
- pNL26 parts:
- GvpA (DNA sequence) (protein sequence)
- EcoRI restriction site 7089 of (original source)
- coden pair change: Isoleucine T57C: [ATT](K12 usage 30%) to [ATC](K12 usage 25%).(adds EcoRV)
- Primer T57AF 5'-ttagcagaagtgattgatcgaatcctcgacaaagggattg-3'
- Primer T57AR 5'-caatccctttgtcgaggattcgatcaatcacttctgctaa-3'
- GvpA (DNA sequence) (protein sequence)
- GvpP (DNA sequence) (protein sequence)
- PstI restriction site 6389 of (original source)
- coden pair change:Glutamine G441A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer G441AF 5'-aatatgaacgaccagctgcaacgcattgaagagatg-3'
- mutation Primer G441AR 5'-catctcttcaatgcgttgcagctggtcgttcatatt-3'
- GvpP (DNA sequence) (protein sequence)
- GvpQ (DNA sequence) (protein sequence)
- PstI two restriction sites 6136 & 6169 of (original source)
- coden pair change:Glutamine G150A,G183A: [CAG](K12 usage 29%) to [CAA](K12 usage 15%).
- mutation Primer #1 G150AF: 5'-aaaactgaagggaaactgcaagaaaaagcaaatgaagcgtc-3'
- mutation Primer #1 G150AR: 5'-gacgcttcatttgctttttcttgcagtttcccttcagtttt-3'
- mutation Primer #1 G183AF: 5'-atgaagcgtcagaaaaactgcaagaaacaaaagaaaaaaatgccc-3'
- mutation Primer #1 G183AR: 5'-gggcatttttttcttttgtttcttgcagtttttctgacgcttcat-3'
- GvpQ (DNA sequence) (protein sequence)
- mutation primer #2
- ORF1 (DNA sequence) (protein sequence)